Carex nemoralis

(K.L.Wilson) K.L.Wilson · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Cyperaceae/Carex

At a glance

Occurrence records234

Data sources5

Biological traits29

DNA specimens0

eDNA detections1

Sources5 archives

Databases and archives Carex nemoralis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility234 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources29 traits

Occurrence & distributionGBIF234 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingNCBIsequences

01Narrative

Uncinia nemoralis là loài thực vật có hoa trong họ Cói. Loài này được K.L.Wilson miêu tả khoa học đầu tiên năm 1994.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFTTRY

Size & morphology7

Fruit length5.1 mm

Fruit width1.3 mm

Leaf width1.9 mm

Leaf width max2.2 mm

Leaf width min1.6 mm

Plant height max0.55 m

Plant height min0.2 m

Life cycle & reproduction9

Dehiscenceindehiscent

Dispersal typeanimal

Flowering timeyynnnnnnyyyy

Life formperennial

Life spanperennial

Pollination syndromeabiotic

Raunkiær life formhemicryptophyte

Resprouting capacityfire_killed

Sex typemonoecious

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typenut utricle

⚠ sources differ — AusTraits: nut utricle · GIFT: nut

Growth formherb

⚠ sources differ — GIFT: herb · AusTraits: graminoid herb

Leaf compoundnesssimple

Woodinessnon-woody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Carex nemoralis has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

eDNA detections1

The DNA barcodea real sequence read deposited for this species

rbcLAY725956.1 ↗1 408 bp

ACGT

TAAAGCAAGTGTTGGGTTTAAAGCAGGGGTTAAAGATTACAAACTTACTTATTATACTCCTGAGTACGAAACCAAAGATACTGATATCTT …

Uncinia nemoralis ribulose-bisphosphate carboxylase large subunit-like (rbcL) gene, partial sequence; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1

plant barcode

08Occurrence & distribution

Record type234 records

Wild obs. + sensor187

Museum / vouchered47

Origin

Native13

Introduced1

Range

Area of Occupancy AOO516 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy96% within 1 km

≤100 m 150≤1 km 30≤10 km 7

187 georeferenced

Open the mapobservation + sensor187

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy58% within 1 km

≤100 m 6≤1 km 13≤10 km 10>10 km 4

33 georeferenced · 14 without coordinates

Open the institutions mapphysical evidence47

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museo Entomologico de Leonlocation not on record	19
Mount Annan, AU	13
Armidale, AU	11
Brisbane, AU	1
Hobart, AU	1
Christchurch, NZ	1
Canberra, AU	1

7 institutions · 47 of 47 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Carex nemoralis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)