Carex muricata
speciesAt a glance
Occurrence records22 961
Data sources10
Biological traits45
DNA specimens43
eDNA detections19
Sources10 archives
Databases and archives Carex muricata's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility22 961 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI19 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics43 specimens↗
NCBIUS National Library of Medicinesequences↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
Paleobiology DatabasePBDB consortiumfossil record↗On this page6 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources45 traits
Occurrence & distributionGBIF22 961 records
Environmental DNA1 datasets · 6 countries19 detections
DNA & barcodingBOLD · NCBI43 specimens
Genome at a glanceCCDB · GoaT381 Mbp
01Narrative
Carex muricata est une espèce de plantes du genre Carex et de la famille des Cyperaceae.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTLEDATRYWCVP
Size & morphology14
Leaf mass23.27 mg
Leaf size316 mm²
⚠ sources differ — TRY: 316 mm² · LEDA: 380 mm² · GIFT: 380 mm²
Leaf width2 mm
Plant height0.283 m
⚠ sources differ — GIFT: 0.283 m · LEDA: 0.275 m · TRY: 0.636 m
Plant height generative0.4 m
Plant height max0.8 m
Plant height min0.15 m
Seed length1.97 mm
Seed mass1.72 mg
⚠ sources differ — TRY: 1.72 mg · LEDA: 1.83 mg · GIFT: 1.8 mg
Seed mass max2.18 mg
Seed mass min1.49 mg
Seed volume1.7 mm³
Seed volume max1.7 mm³
Seed volume min1.7 mm³
Life cycle & reproduction13
Deciduousnessevergreen
Dehiscenceindehiscent
Dispersal typeself
⚠ sources differ — LEDA: autochor · GIFT: unspecialized
Flowering endJul
Flowering startMay
Life formperennial or rhizomatous geophyte
Life spanperennial
Pollination modeabiotic
Pollination syndromewind
Raunkiær life formhemicryptophyte
Reproduction asexualabsent
Seed number40 776
Self fertilizationabsent
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment10
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Epiphyteterrestrial
Fruit fleshinessdry
Fruit typeachene
Growth formherb
Habitat GIFTforest, meadows: wet, swamps
Mycorrhiza typearbuscular
Woodinessnon-woody
Physiology & chemistry5
Leaf dry-matter content (LDMC)338 mg/g
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
Seed longevity index0.5
Specific leaf area (SLA)18.1 mm²/mg
⚠ sources differ — LEDA: 18.1 mm²/mg · GIFT: 17.07 mm²/mg
Other traits1
Diaspore typefruit with appendage
05DNA & barcoding43 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Carex muricata has left across the world's sequence archives.
At a glance
DNA specimens43
Marker genes7
GenBank sequences10
eDNA detections19
Countries7
The DNA barcodea real sequence read deposited for this species
AACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTT …
Carex muricata isolate C061 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK4★rbcL1★rbcLa★trnL-F★ITS5★ITS1★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB · GoaT
The complete instruction manual Carex muricata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size381 420 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Carex muricata0.38 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 58 n = 29
Chromosome records56–582n range58median58mode17records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 5811×GoaT · Kew Plant DNA C-values Database · CCDB · slov-fl · CCDB · cyper-only +3
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · slov-fl — Májovský J., Uhríková A., Javorčíková D., Mičieta K., Králik E., Dúbravcová Z., Feráková V., Murín A., Černušáková D., Hindáková M., Schwarzová T. & Záborský J., 2000: Prvý doplnok karyotaxonomického prehľadu flóry Slovenska. - Acta Fac. Rerum Nat. Univ. Comen., Bot. Supplementum Nr. 1: 1-127.
CCDB · cyper-only — Heilborn, O.1924
CCDB · cyper-only — Tischler, G.1934
CCDB · cyper-only — Rohweder, H.1937
CCDB · cyper-only — Tanaka, N.1942f
CCDB · cyper-only — Hartvig, P.1986
CCDB · ipcn-api-dl — Hartvig, P. 1986. Chromosome numbers in Nordic populations of the Carex muricata group (Cyperaceae). Symb. Bot. Upsal. 27: 127–138.
CCDB · ipcn-api-dl — Stoeva, M. & E. Popova. 1997. A taxonomic study of Carex sect. Phaestoglochin and sect. Stellulatae (Cyperaceae) in Bulgaria. Bocconea 5: 787–796.
CCDB · kew — Lipnerová I, Bureš P, Horová L, Šmarda P. 2012. Evolution of genome size in Carex (Cyperaceae) in relation to chromosome number and genomic base composition. Annals of Botany.
CCDB · CromoCat 2015 — Hartvig, P. (1986). Chromosome numbers in Nordic populations of the Carex muricata group (Cyperaceae). Symbolae Botanicae Upsaliensis 27: 127-138
2n 566×CCDB · nw-europe-fl · CCDB · cyper-only · CCDB · ipcn-api-dl +1
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=4329
CCDB · cyper-only — Natarajan, G.1979a
CCDB · cyper-only — Natarajan, G.1979b
CCDB · ipcn-api-dl — Natarajan, G. 1979. Etude caryosystematique de quelques monocotyledones de la garrigue Languedocienne. Nat. Monspel., Sér. Bot. 30: 1–27.
CCDB · ipcn-api-dl — Natarajan, G. 1979a. In IOPB chromosoJne number reports LXV. Taxon 28: 629.
CCDB · CromoCat 2015 — Natarajan, G. (1979a). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXV]. Taxon 28(5/6): 629.
2n 551×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Stoeva, M. & E. Popova. (1997). A taxonomic study of Carex sect. Phaestoglochin and sect. Stellulatae (Cyperaceae) in Bulgaria. Bocconea 5: 787-796
n 293×CCDB · cyper-only · CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · cyper-only — Hartvig, P.1986
CCDB · ipcn-api-dl — Hartvig, P. 1986. Chromosome numbers in Nordic populations of the Carex muricata group (Cyperaceae). Symb. Bot. Upsal. 27: 127–138.
CCDB · CromoCat 2015 — Mehra, P. N. & S. K. Sachdeva. (1971). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports XXXIII]. Taxon 20(4): 611-613.
n 352×CCDB · Cave1956 · CCDB · Cave1956supp
CCDB · Cave1956 — Davies a, b
CCDB · Cave1956supp — Davies 1955
n 341×CCDB · book-ipcn72
CCDB · book-ipcn72 — DIETRICH, w. 1972. In IOPB chromosome number reports XXXVI. Taxon 21: 333-346.
n 401×CCDB · iapt
CCDB · iapt — IAPT/IOPB Chromosome Data 25
08Occurrence & distribution
Record type22 961 records
Wild obs. + sensor16 854
Museum / vouchered5 345
Cultivated / captive141
Other621
Origin
Native450
Introduced14
Range
Area of Occupancy AOO53 728 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy63% within 1 km
≤100 m 3 976≤1 km 3 688≤10 km 4 306>10 km 272
12 242 georeferenced · 4 612 without coordinates
Open the mapobservation + sensor16 854
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy44% within 1 km
≤100 m 659≤1 km 1 043≤10 km 1 441>10 km 722
3 865 georeferenced · 1 480 without coordinates
Open the institutions mapphysical evidence5 345
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy
no georeferenced coordinates · 141 records without
Open the mapnot free-living141
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions96 of 185 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 966 |
| Helsinki, FI | 572 |
| Olocation not on record | 375 |
| Moscow State Universitylocation not on record | 245 |
| Tartu, EE | 224 |
| Trondheim, NO | 218 |
| Uppsala, SE | 211 |
| BRNUlocation not on record | 179 |
| LDlocation not on record | 151 |
| Turku, FI | 146 |
| Salzburg, AT | 133 |
| SLU Artdatabankenlocation not on record | 106 |
| Mlocation not on record | 89 |
| Oulu, FI | 68 |
| Provincia di Livornolocation not on record | 62 |
| Christchurch, NZ | 60 |
| MeiseBGlocation not on record | 59 |
| GJOlocation not on record | 52 |
| Nijmegen, NL | 40 |
| Wlocation not on record | 40 |
| Oskarshamn, SE | 39 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 38 |
| KMNlocation not on record | 36 |
| Kuopio, FI | 35 |
| Görlitz, DE | 33 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 33 |
| Tallinn, EE | 33 |
| Aarhus, DK | 32 |
| Berlin, DE | 32 |
| Moscow, US | 30 |
| Bern, CH | 29 |
| València, ES | 29 |
| BFLlocation not on record | 25 |
| South Kensington, GB | 24 |
| Xiamen, CN | 24 |
| PrivatHerblocation not on record | 23 |
| Barcelona, ES | 22 |
| BIO-UNIPIlocation not on record | 20 |
| TUR-Alocation not on record | 19 |
| BClocation not on record | 19 |
| Philadelphia, US | 19 |
| Frankfurt am Main | 18 |
| Wellington, NZ | 16 |
| Jyväskylä, FI | 16 |
| BDBClocation not on record | 16 |
| Bergen, NO | 16 |
| H-Adlerlocation not on record | 15 |
| GZUlocation not on record | 15 |
| Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record | 12 |
| Dresden, DE | 12 |
| Bronx, US | 11 |
| MAlocation not on record | 11 |
| McWane Science Centerlocation not on record | 10 |
| Wuzhou, CN | 10 |
| Fulda, DE | 10 |
| Auckland, NZ | 10 |
| Chicago, US | 10 |
| Porvoo, FI | 10 |
| PRClocation not on record | 9 |
| nbflocation not on record | 9 |
| Uniwersytet Śląski w Katowicachlocation not on record | 9 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 9 |
| Karlsruhe, DE | 8 |
| Zürich, CH | 8 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 8 |
| Toronto, CA | 8 |
| Angwin, US | 8 |
| Madrid, ES | 8 |
| Zürich, CH | 7 |
| University of Wisconsinlocation not on record | 7 |
| Vitoria, ES | 7 |
| Vancouver, CA | 7 |
| Adam Mickiewicz University in Poznańlocation not on record | 6 |
| John May Museum of Natural Historylocation not on record | 6 |
| BSBIlocation not on record | 6 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 6 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 6 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 6 |
| NMBU:MINAlocation not on record | 6 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 6 |
| Stockholm, SE | 6 |
| Winterthur, CH | 6 |
| Forssa, FI | 5 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 5 |
| Sevilla, ES | 5 |
| Salamanca, ES | 5 |
| Entomological Society of Latvialocation not on record | 5 |
| Royal Botanical Gardenslocation not on record | 5 |
| Obihiro Centennial City Museumlocation not on record | 5 |
| NTNU University Museum, Department of Natural Historylocation not on record | 4 |
| Jaén, ES | 4 |
| H-Schuhwlocation not on record | 4 |
| Madison, US | 4 |
| Phyletisches Museum Jenalocation not on record | 4 |
| H-AkrKGlocation not on record | 4 |
| Department of Bacteriology, University of Wisconsinlocation not on record | 4 |
| Salvador, BR | 4 |
| Bangkok, TH | 4 |
| Naturalis Biodiversity Centerlocation not on record | 3 |
| TROMlocation not on record | 3 |
| Kew, GB | 3 |
| Bozeman, US | 3 |
| Ypsilanti, US | 3 |
| Rotorua, NZ | 3 |
| New Haven, US | 3 |
| Finnish Museum of Natural Historylocation not on record | 3 |
| WTUlocation not on record | 3 |
| Quito, EC | 3 |
| UIBlocation not on record | 3 |
| Bourges, FR | 3 |
| University of Stellenboschlocation not on record | 3 |
| Rovaniemi, FI | 2 |
| Hobart, AU | 2 |
| Universidad de La Salle (La Salle)location not on record | 2 |
| Tacoma, US | 2 |
| Ann Arbor, US | 2 |
| Missoula, US | 2 |
| Granada, ES | 2 |
| NoColllocation not on record | 2 |
| Senckenberg Institute for Plant Form and Function at Friedrich Schiller University Jenalocation not on record | 2 |
| Tromso University Museumlocation not on record | 2 |
| Québec, CA | 2 |
| Pullman, US | 2 |
| Staten Island, US | 2 |
| Natural History Museum Rotterdamlocation not on record | 2 |
| Edinburgh, GB | 2 |
| Córdoba, ES | 2 |
| H-Vollrathlocation not on record | 2 |
| Samara National Research Universitylocation not on record | 2 |
| Logan, US | 2 |
| Urumqi, CN | 2 |
| Museo Achille Folettolocation not on record | 2 |
| Chongqing Museumlocation not on record | 1 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 1 |
| Podgorica, ME | 1 |
| DOI/NPS, Mississippi National River & Recreation Arealocation not on record | 1 |
| Denver, US | 1 |
| Musée des Confluenceslocation not on record | 1 |
| Dhaka, BD | 1 |
| München, DE | 1 |
| Davenport, US | 1 |
| H-Meierottlocation not on record | 1 |
| FLADlocation not on record | 1 |
| College of the Atlantic, Museumlocation not on record | 1 |
| Whitewater, US | 1 |
| CICYTEXlocation not on record | 1 |
| WINlocation not on record | 1 |
| Royal Botanic Garden Edinburghlocation not on record | 1 |
| Pamplona, ES | 1 |
| Coimbra, PT | 1 |
| Williamsburg, US | 1 |
| AUAlocation not on record | 1 |
| Porrentruy, CH | 1 |
| University of British Columbialocation not on record | 1 |
| Umeå Universitylocation not on record | 1 |
| Richmond, US | 1 |
| Santa Barbara, US | 1 |
| Portland, US | 1 |
| University of Oxfordlocation not on record | 1 |
| SWlocation not on record | 1 |
| Monastir, TN | 1 |
| LfUlocation not on record | 1 |
| DOI/NPS, Mount Rainier National Parklocation not on record | 1 |
| The Tula Region State Institution of Culture "Tula Museum Association"location not on record | 1 |
| Alicante, ES | 1 |
| IPE-CSIClocation not on record | 1 |
| Provo, US | 1 |
| CJBGlocation not on record | 1 |
| UnBlocation not on record | 1 |
| Oregon State Universitylocation not on record | 1 |
| Sant Julià de Lòria, AD | 1 |
| Norfolk, US | 1 |
| G. Peyrelocation not on record | 1 |
| College Park, US | 1 |
| Weber State Universitylocation not on record | 1 |
| Pocatello, US | 1 |
| Museo Entomologico de Leonlocation not on record | 1 |
| BG-NMNHSlocation not on record | 1 |
| Ashland, US | 1 |
| New Brunswick, US | 1 |
| Philadelphia, US | 1 |
| San Sebastián, ES | 1 |
| Bend, US | 1 |
| Uniwersytet Opolskilocation not on record | 1 |
| Brussel, BE | 1 |
185 institutions · 5 185 of 5 345 vouchered records shown · 122 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA19 detections
Where the DNA of Carex muricata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found19
Studies independent surveys1
Countries6
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 19 detections have coordinates
Open the map6 countries0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median14.9 °C 9.90–16.7
Seasonal swing summer↔winter16.2 °C
Max temp (day)17.8 °C 11.7–20.6
Min temp (night)10.8 °C 6.50–13.3
Precipitation81.0 mm/mo 70.9–142
Air humidity62.0 % 60.5–66.0
Moisture balance-15.1 mm/mo -39.2–38.4
Vapour deficit614 Pa 463–746
Wind speed3.30 m/s 2.10–5.40
Cloud cover48.4 % 36.8–56.0
CHELSA 1981–2010, ~9 km grid, at location & month of 17 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.