Carex munda — The Life Data

Plantae/Tracheophyta/Liliopsida/Poales/Cyperaceae/Carex

At a glance

Occurrence records52

Data sources5

Biological traits11

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Carex munda's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility52 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources11 traits

Occurrence & distributionGBIF52 records

DNA & barcodingNCBIsequences

01Narrative

Carex munda ist eine Art der Sauergräser. Sie ist ein relativ kleinwüchsiger Vertreter der Gattung der Seggen (Carex) und wird in die Sektion Mundae gestellt. Sie wächst in Tannenwäldern und auf Bergwiesen des östlichen Himalayas und ist in Südostxichang, Bhutan, Nepal und Nordostindien beheimatet.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formperennial or rhizomatous geophyte

Lifeform raunkiaer detailedgeophyte

Diet & foraging1

Parasiteindependent

Habitat & environment7

Climatesubalpine or subarctic

Climberself-supporting

Elevation max4 300 m

Elevation min3 000 m

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Other traits1

Plant support typefree-standing

05DNA & barcoding5 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Carex munda has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences5

Countries2

The DNA barcodea real sequence read deposited for this species

ITSPZ307219.1 ↗615 bpNepal · 2021

ACGT

TCGTTGCCTTCCCGAAAACACGACCGTTGAACACGTGACAGAATGCTGCCGCGGGGGTGCCTGCTGCCTCCTCGGCCCCACCGGCCTCCT …

Carex munda voucher MB068 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

matK2ITS3

plant barcodefungal barcode

08Occurrence & distribution

Record type52 records

Museum / vouchered52

Range

Area of Occupancy AOO144 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 10

10 georeferenced · 42 without coordinates

Open the institutions mapphysical evidence52

10Collections & institutions

Holding institutions5 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Herbarium of the Department of Botany, University of Tokyolocation not on record	20
GMBAlocation not on record	10
Beijing, CN	6
Xining, CN	6
Edinburgh, GB	5
Bronx, US	2
Kew, GB	1

7 institutions · 50 of 52 vouchered records shown · 2 without an institution code