Carex mucronata

All. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Cyperaceae/Carex

At a glance

Occurrence records7 123

Data sources8

Biological traits29

DNA specimens4

eDNA detections1

Sources8 archives

Databases and archives Carex mucronata's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility7 123 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources29 traits

Occurrence & distributionGBIF7 123 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI4 specimens

Genome at a glanceCCDB · GoaT665 Mbp

01Narrative

Carex mucronata est une espèce de plantes du genre Carex et de la famille des Cyperaceae.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTLEDATRYWCVP

Size & morphology9

Leaf size30.33 mm²

Plant height0.165 m

⚠ sources differ — GIFT: 0.165 m · LEDA: 0.165 m · TRY: 0.068 m

Plant height generative0.2 m

Plant height max0.3 m

Plant height min0.1 m

Seed length4.11 mm

Seed mass0.83 mg

Seed mass max0.83 mg

Seed mass min0.83 mg

Life cycle & reproduction7

Deciduousnessevergreen

Dispersal typeanimal

Flowering endAug

Flowering startMay

Life formperennial or rhizomatous geophyte

Life spanperennial

Raunkiær life formhemicryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Habitat GIFTmountains, stony places

Woodinessnon-woody

Physiology & chemistry3

Leaf dry-matter content (LDMC)406 mg/g

Photosynthetic pathwayC3

Specific leaf area (SLA)6.06 mm²/mg

Other traits2

Diaspore typefruit with appendage

Plant support typefree-standing

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Carex mucronata has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes3

GenBank sequences3

eDNA detections1

Countries2

The DNA barcodea real sequence read deposited for this species

ITSMN762456.1 ↗661 bpItaly

ACGT

TTGTCGTTGCCTTTCCGAAAACACGACCGTCGAACACGTGACAGAATGCCGCCGCGGGGGCGCTCGCCGCCTCCTCGGCCCCACCGGCCT …

Carex mucronata isolate spm00000534 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcLa★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Carex mucronata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size665 040 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Carex mucronata0.67 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 36 n = 18

Chromosome records34–362n range36median36mode12records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 3610×GoaT · Kew Plant DNA C-values Database · CCDB · ita-fl · CCDB · fl-europaea +3

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · ita-fl — DIETRICH W. - 1967. Die Zytotaxonomie der "Carex" Sektion "Frigidae" in Europa.. Feddes Repert. , 75(12): 1/1/1942.

CCDB · fl-europaea — Dietrich, 1967

CCDB · cyper-only — Dietrich, W.1967

CCDB · cyper-only — Druskovic, L. P.1995

CCDB · ipcn-api-dl — Druskovic, B. 1995. IOPB chromosome data 9. Int. Organ. Pl. Biosyst. Newslett. (Zurich) 24: 11–14.

CCDB · book-ipcn67-71 — DIETRICH, w. 1967. Die Zytotaxonomie der Carex-Sektion Frigidae in Europa. Fedd. Rap. 75: 1-42.

2n 342×CCDB · fl-europaea · CCDB · cyper-only

CCDB · fl-europaea — Dietrich, 1964

CCDB · cyper-only — Dietrich, J.1964

08Occurrence & distribution

Record type7 123 records

Wild obs. + sensor6 407

Museum / vouchered625

Cultivated / captive1

Other90

Range

Area of Occupancy AOO4 776 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy68% within 1 km

≤100 m 280≤1 km 2 504≤10 km 1 251>10 km 67

4 102 georeferenced · 2 305 without coordinates

Open the mapobservation + sensor6 407

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy35% within 1 km

≤100 m 27≤1 km 106≤10 km 248>10 km 2

383 georeferenced · 242 without coordinates

Open the institutions mapphysical evidence625

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions15 of 40 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Salzburg, AT	110
BFLlocation not on record	77
Provincia di Livornolocation not on record	74
GJOlocation not on record	68
BIO-UNIPIlocation not on record	64
GZUlocation not on record	31
Glarus, CH	22
Bern, CH	21
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	16
BRNUlocation not on record	15
Wlocation not on record	13
Institut und Museum fuer Geologie und Palaeontologielocation not on record	12
Herb. BBGlocation not on record	12
SZUlocation not on record	11
LDlocation not on record	10
Görlitz, DE	10
Mlocation not on record	9
Frankfurt am Main	7
Dresden, DE	5
LfUlocation not on record	4
Oskarshamn, SE	3
PRClocation not on record	3
Dhaka, BD	3
Porrentruy, CH	2
Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record	2
Wellington, NZ	2
Adam Mickiewicz University in Poznańlocation not on record	2
Berlin, DE	1
NoColllocation not on record	1
Auckland, NZ	1
Moscow State Universitylocation not on record	1
CJBGlocation not on record	1
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	1
Muséum d'histoire naturelle Jacques de la Comblelocation not on record	1
BClocation not on record	1
Barcelona, ES	1
Beijing, CN	1
University of Toronto Mississaugalocation not on record	1
ULBF-AGRlocation not on record	1
Fribourg, CH	1

40 institutions · 621 of 625 vouchered records shown · 4 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Carex mucronata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Carex mucronata

At a glance

Sources8 archives

Size & morphology9

Life cycle & reproduction7

Diet & foraging1

Habitat & environment7

Physiology & chemistry3

Other traits2

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Record type7 123 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions15 of 40 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Record type7 123 records