Carex montana
speciesAt a glance
Occurrence records91 703
Data sources11
Biological traits40
DNA specimens33
eDNA detections39
Sources11 archives
Databases and archives Carex montana's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility91 703 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI39 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics33 specimens↗
NCBIUS National Library of Medicinesequences↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
Paleobiology DatabasePBDB consortiumfossil record↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page6 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources40 traits
Occurrence & distributionGBIF91 703 records
Environmental DNA3 datasets · 4 countries39 detections
DNA & barcodingBOLD · NCBI33 specimens
Genome at a glanceCCDB · GoaT411 Mbp
01Narrative
Carex montana, la Laîche des montagnes, est une espèce de plantes du genre Carex et de la famille des Cyperaceae. La photo de presentation n'est pas celle d'un carex montana qui pousse dans les prairies et ne fait pas de touradons.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTLEDATRYWCVP
Size & morphology10
Leaf mass11.84 mg
Leaf size316 mm²
⚠ sources differ — TRY: 316 mm² · LEDA: 289 mm² · GIFT: 289 mm²
Plant height0.165 m
⚠ sources differ — GIFT: 0.165 m · LEDA: 0.165 m · TRY: 0.146 m
Plant height generative0.2 m
Plant height max0.3 m
Plant height min0.1 m
Seed length2.75 mm
Seed mass1.03 mg
⚠ sources differ — TRY: 1.03 mg · LEDA: 0.65 mg · GIFT: 0.82 mg
Seed mass max0.99 mg
Seed mass min0.99 mg
Life cycle & reproduction12
Deciduousnessaestival
⚠ sources differ — TRY: aestival · GIFT: deciduous
Dispersal typeself
Flowering endMay
Flowering startMar
Life formperennial or rhizomatous geophyte
Life spanperennial
Lifespan years3 years
Pollination modeabiotic
Pollination syndromewind
Raunkiær life formhemicryptophyte
Seed number28
Self fertilizationabsent
Diet & foraging1
Parasiteindependent
Habitat & environment8
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Epiphyteterrestrial
Growth formherb
⚠ sources differ — GIFT: herb · TRY: Grasses&Sedges
Habitat GIFTforest, mountains
Mycorrhiza typenon-mycorrhizal
Woodinessnon-woody
Physiology & chemistry8
Leaf C:N ratio25.91 g/g
Leaf c459 mg/g
Leaf dry-matter content (LDMC)379 mg/g
⚠ sources differ — TRY: 379 mg/g · LEDA: 315 mg/g
Leaf n18.31 mg/g
Leaf p1.7 mg/g
Photosynthetic pathwayC3
Seed longevity index0
Specific leaf area (SLA)16.02 mm²/mg
⚠ sources differ — TRY: 16.02 mm²/mg · LEDA: 17.7 mm²/mg · GIFT: 19.64 mm²/mg
Other traits1
Diaspore typefruit with appendage
05DNA & barcoding33 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Carex montana has left across the world's sequence archives.
At a glance
DNA specimens33
Marker genes6
GenBank sequences10
eDNA detections39
Countries7
The DNA barcodea real sequence read deposited for this species
TGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCAAGGGACCCTCCCGAGGGCACGCCTGCCTCATGGGCGTTAGAAG …
Carex montana voucher NMW3056 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK4★rbcL2★rbcLa★ITS4★ITS1★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB · GoaT
The complete instruction manual Carex montana carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size410 760 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Carex montana0.41 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 38 n = 19
Chromosome records38–482n range38median38mode45records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 3832×GoaT · DTOL Flowering Plants Estimates Kew · GoaT · Kew Plant DNA C-values Database · CCDB · slov-fl +7
GoaT · DTOL Flowering Plants Estimates Kew
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · slov-fl — Májovský J. & Váchová M., 1986: Karyological study of the Slovak flora XIII. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 33: 63-67.
CCDB · slov-fl — Májovský J., Murín A., Feráková V., Hindáková M., Schwarzová T., Uhríková A., Váchová M. & Záborský J., 1987: Karyotaxonomický prehľad flóry Slovenska. Veda, Bratislava.
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=4382
CCDB · fl-europaea — Dietrich, 1972
CCDB · poland — Pogan E., Jankun A., Ma?ecka J., Wcis?o H. et al. 1986. Further studies in chromosome numbers of Polish Angiosperms. Part XIX. Acta Biol. Cracov. Ser. Bot. 28, 65-85.
CCDB · cyper-only — Heilborn, O.1922
CCDB · cyper-only — Heilborn, O.1924
CCDB · cyper-only — Tischler, G.1934
CCDB · cyper-only — Heilborn, O.1937
CCDB · cyper-only — Dietrich, W.1972
CCDB · cyper-only — Majovsky, J. & M. Vachova1986
CCDB · cyper-only — Pogan, E., A. Jankun, J. Malecka & H. Wcislo1986
CCDB · cyper-only — Stoeva, M. P.1987a
CCDB · cyper-only — Semerenko, L. V.1990
CCDB · cyper-only — Stoeva, M. P. & E. D. Popova1993
CCDB · cyper-only — Druskovic, L. P.1995
CCDB · cyper-only — Dobes, C., B. Hahn & W. Morawetz1997
CCDB · ipcn-api-dl — Stoeva, M. P. 1987. Chromosome numbers of Bulgarian angiosperms. Fitologija 33: 65–66.
CCDB · ipcn-api-dl — Pogan, E., A. Jankun, J. Maslecka & H. Wcisslo. 1986. Further studies in chromosome numbers of Polish angiosperms. Part XIX. Acta Biol. Cracov., Ser. Bot. 28: 65–85.
CCDB · ipcn-api-dl — Semerenko, L. V. 1990. Chromosome numbers of some flowering plants from the Berezinsky Biosphere Reservation (the Byelorussian Soviet Socialist Republic). Bot. Žhurn. (Moscow & Leningrad) 75: 279–282.
CCDB · ipcn-api-dl — Májovský, J. & M. Váchová. 1986. Karyological study of the Slovak flora XIII. Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 33: 63–67.
CCDB · ipcn-api-dl — Stoeva, M. P. & E. D. Popova. 1993. Cytotaxonomic study on Carex sect. Acrocystis (Cyperaceae) in Bulgaria. Fragm. Florist. Geobot. 38: 29–43.
CCDB · ipcn-api-dl — Druskovic, B. 1995. IOPB chromosome data 9. Int. Organ. Pl. Biosyst. Newslett. (Zurich) 24: 11–14.
CCDB · ipcn-api-dl — Dobea, C., B. Hahn & W. Morawetz. 1997. Chromosomenzahlen zur Gefässpflanzen-Flora Österreichs. Linzer Biol. Beitr. 29(1): 5–43.
CCDB · book-ipcn72 — DIETRICH, w. 1972. In IOPB chromosome number reports XXXVI. Taxon 21: 333-346.
CCDB · CromoCat 2015 — Rotreklová, O. & Bureš, P. & ?epka, R. & Grulich, V. & Šmarda, P. & Hralová, I. & Zedek, F.& Koutecký, T. (2011). Chromosome numbers of Carex Preslia 83: 25–58
CCDB · CromoCat 2015 — Dietrich, W. (1972). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports XXXVI]. Taxon 21(2/3): 333-335.
CCDB · CromoCat 2015 — Dobeš, C., Hahn, B. & Morawetz, W. (1997). Chromosomenzahlen zur Gefässpflanzen-Flora Österreichs. Linzer Biol. Beitr. 29(1): 5-43.
CCDB · CromoCat 2015 — Druskovic, B. (1995). IOPB Chromosome Data 9 (ed. C.A. Stace). Int. Organ. Pl. Biosyst. Newslett. 24: 11-14.
CCDB · CromoCat 2015 — Stoeva, M. P. (1987a). Chromosome numbers of Bulgarian Angiosperms. Fitologija 33: 65-66.
2n 4812×CCDB · slov-fl · CCDB · nw-europe-fl · CCDB · fl-europaea +3
CCDB · slov-fl — Májovský J., Uhríková A., Javorčíková D., Mičieta K., Králik E., Dúbravcová Z., Feráková V., Murín A., Černušáková D., Hindáková M., Schwarzová T. & Záborský J., 2000: Prvý doplnok karyotaxonomického prehľadu flóry Slovenska. - Acta Fac. Rerum Nat. Univ. Comen., Bot. Supplementum Nr. 1: 1-127.
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=4380
CCDB · fl-europaea — Dietrich, 1972
CCDB · cyper-only — 78Stoeva, M. P.1992c
CCDB · cyper-only — 78Stoeva, M. P. & E. D. Popova1993
CCDB · cyper-only — 78Druskovic, L. P.1995
CCDB · ipcn-api-dl — Stoeva, M. P. 1992. Chromosome numbers of Bulgarian Cyperaceae. Fitologija 43: 77–78.
CCDB · ipcn-api-dl — Stoeva, M. P. & E. D. Popova. 1993. Cytotaxonomic study on Carex sect. Acrocystis (Cyperaceae) in Bulgaria. Fragm. Florist. Geobot. 38: 29–43.
CCDB · ipcn-api-dl — Druskovic, B. 1995. IOPB chromosome data 9. Int. Organ. Pl. Biosyst. Newslett. (Zurich) 24: 11–14.
CCDB · ipcn-api-dl — Lövkvist, B. & U. M. Hultgård. 1999. Chromosome numbers in south Swedish vascular plants. Opera Bot. 137: 1–42.
CCDB · ipcn-api-dl — Hayirlioğlu-Ayaz, S., A. Olgun & O. Beyazoğlu. 2001. Chromosome numbers of some Carex species from northeast Anatolia. Biologia (Bratislava) 56: 381–387.
CCDB · book-atlas-flowering-plants — Heilbom 1939
2n 461×CCDB · cyper-only
CCDB · cyper-only — 78Hayirlioglu-Ayaz, S., A. Olgun & O. Beyazoglu2001
n 244×CCDB · cyper-only · CCDB · book-ipcn72 · CCDB · Cave1956
CCDB · cyper-only — Davies, E. W.1956a
CCDB · cyper-only — 78Dietrich, W.1972
CCDB · book-ipcn72 — DIETRICH, w. 1972. In IOPB chromosome number reports XXXVI. Taxon 21: 333-346.
CCDB · Cave1956 — Davies b
n 193×CCDB · cyper-only · CCDB · Cave1956
CCDB · cyper-only — Davies, E. W.1956a
CCDB · cyper-only — Davies, E. W.1956b
CCDB · Cave1956 — Davies a, b
08Occurrence & distribution
Record type91 703 records
Wild obs. + sensor84 880
Museum / vouchered5 266
Cultivated / captive95
Other1 462
Origin
Native579
Introduced6
Range
Area of Occupancy AOO79 872 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy30% within 1 km
≤100 m 12 695≤1 km 7 099≤10 km 46 704>10 km 278
66 776 georeferenced · 18 104 without coordinates
Open the mapobservation + sensor84 880
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy41% within 1 km
≤100 m 345≤1 km 967≤10 km 1 691>10 km 193
3 196 georeferenced · 2 070 without coordinates
Open the institutions mapphysical evidence5 266
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy60% within 1 km
≤1 km 3>10 km 2
5 georeferenced · 90 without coordinates
Open the mapnot free-living95
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions49 of 111 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 1 361 |
| BFLlocation not on record | 468 |
| LDlocation not on record | 388 |
| Uppsala, SE | 299 |
| Moscow State Universitylocation not on record | 248 |
| BRNUlocation not on record | 223 |
| SLU Artdatabankenlocation not on record | 184 |
| Provincia di Livornolocation not on record | 164 |
| GJOlocation not on record | 141 |
| South Kensington, GB | 133 |
| Oskarshamn, SE | 132 |
| Salzburg, AT | 117 |
| Tartu, EE | 108 |
| MeiseBGlocation not on record | 83 |
| Adam Mickiewicz University in Poznańlocation not on record | 68 |
| BIO-UNIPIlocation not on record | 63 |
| Tallinn, EE | 51 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 50 |
| Mlocation not on record | 47 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 43 |
| Wlocation not on record | 40 |
| Bern, CH | 39 |
| Barcelona, ES | 33 |
| BDBClocation not on record | 27 |
| KFGBlocation not on record | 26 |
| Görlitz, DE | 25 |
| PRClocation not on record | 24 |
| DBF-NHMDlocation not on record | 23 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 23 |
| LfUlocation not on record | 23 |
| BClocation not on record | 20 |
| Porrentruy, CH | 19 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 18 |
| Dresden, DE | 17 |
| SZUlocation not on record | 17 |
| Philadelphia, US | 15 |
| University of Birminghamlocation not on record | 14 |
| Frankfurt am Main | 14 |
| Frauenfeld, CH | 13 |
| Auckland, NZ | 13 |
| Fulda, DE | 12 |
| Berlin, DE | 11 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 11 |
| Uniwersytet Śląski w Katowicachlocation not on record | 11 |
| The State Museum-Preserve "The Kulikovo pole"location not on record | 11 |
| Winterthur, CH | 10 |
| CJBGlocation not on record | 10 |
| Glarus, CH | 10 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 8 |
| Karlsruhe, DE | 8 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 8 |
| John May Museum of Natural Historylocation not on record | 8 |
| PrivatHerblocation not on record | 8 |
| GZUlocation not on record | 7 |
| Tula State Universitylocation not on record | 6 |
| Vitoria, ES | 6 |
| Salamanca, ES | 5 |
| MAlocation not on record | 5 |
| H-Schuhwlocation not on record | 5 |
| Herb. BBGlocation not on record | 5 |
| National Museum Waleslocation not on record | 4 |
| Wellington, NZ | 4 |
| Bourges, FR | 4 |
| Entomological Society of Latvialocation not on record | 4 |
| Sion, CH | 4 |
| Christchurch, NZ | 3 |
| Servico de Microbiologia e Imunologialocation not on record | 3 |
| Uniwersytet Marii Curie-Skłodowskiejlocation not on record | 3 |
| Kostrzyca Forest Gene Banklocation not on record | 3 |
| Natural History Museum, Londonlocation not on record | 3 |
| Lausanne, CH | 3 |
| Uniwersytet Warszawskilocation not on record | 3 |
| Helsinki, FI | 3 |
| San Sebastián, ES | 3 |
| Musée des Confluenceslocation not on record | 2 |
| Museo Achille Folettolocation not on record | 2 |
| València, ES | 2 |
| Zürich, CH | 2 |
| Denver, US | 2 |
| Zürich, CH | 2 |
| San Angelo, US | 2 |
| Oulu, FI | 2 |
| FLADlocation not on record | 2 |
| Porvoo, FI | 2 |
| Granada, ES | 2 |
| KMNlocation not on record | 2 |
| Uniwersytet Opolskilocation not on record | 2 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 2 |
| Instytut Ochrony Przyrody Polskiej Akademii Nauklocation not on record | 1 |
| Stockholm, SE | 1 |
| H-AkrKGlocation not on record | 1 |
| Pamplona, ES | 1 |
| Madrid, ES | 1 |
| Namur, BE | 1 |
| Finnish Museum of Natural Historylocation not on record | 1 |
| H-Wolflocation not on record | 1 |
| Royal Botanic Gardens, Kewlocation not on record | 1 |
| Bangkok, TH | 1 |
| Trondheim, NO | 1 |
| Göteborg, SE | 1 |
| Saint Louis, US | 1 |
| Universidad de La Salle (La Salle)location not on record | 1 |
| National Botanic Garden of Waleslocation not on record | 1 |
| University of Stellenboschlocation not on record | 1 |
| San Isidro, AR | 1 |
| CICYTEXlocation not on record | 1 |
| München, DE | 1 |
| Kew, GB | 1 |
| Xiamen, CN | 1 |
| College of the Atlantic, Museumlocation not on record | 1 |
| UNINE:NEUlocation not on record | 1 |
111 institutions · 5 077 of 5 266 vouchered records shown · 123 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA39 detections
Where the DNA of Carex montana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found39
Studies independent surveys3
Countries4
Signal confidence: moderateweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 39 detections have coordinates
Open the map4 countries0
Grown in Garden of Wales
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median12.7 °C 12.4–12.7
Seasonal swing summer↔winter21.6 °C
Max temp (day)16.8 °C 15.3–16.8
Min temp (night)9.40 °C 8.10–9.40
Precipitation57.1 mm/mo 57.1–61.9
Air humidity62.6 % 62.5–63.1
Moisture balance-10.2 mm/mo -16.2–-8.00
Vapour deficit551 Pa 518–558
Wind speed4.10 m/s 4.10–4.70
Cloud cover37.8 % 37.8–47.5
CHELSA 1981–2010, ~9 km grid, at location & month of 34 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.