Carex melanostachya

M.Bieb. ex Willd. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Cyperaceae/Carex

At a glance

Occurrence records5 366

Data sources9

Biological traits26

DNA specimens9

eDNA detections8

Sources9 archives

Databases and archives Carex melanostachya's data was compiled from.

WikipediaWikimedia Foundation8 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility5 366 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources26 traits

Occurrence & distributionGBIF5 366 records

Environmental DNA1 datasets · 1 countries8 detections

DNA & barcodingBOLD · NCBI9 specimens

Genome at a glanceCCDB · GoaT372 Mbp

01Narrative

Carex melanostachya, called the Great Plains sedge, is a species of flowering plant in the genus Carex, native to central Europe to western Asia, and introduced to the central US. Its chromosome number is 2n=54, with some uncertainty.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTLEDATRYWCVP

Size & morphology5

Plant height0.4 m

⚠ sources differ — GIFT: 0.4 m · LEDA: 0.4 m · TRY: 0.5 m

Plant height generative0.4 m

Plant height max0.6 m

Plant height min0.15 m

Seed mass2.83 mg

Life cycle & reproduction8

Deciduousnessevergreen

Dispersal typeself

Life formperennial or rhizomatous geophyte

Life spanperennial

Pollination modeabiotic

Pollination syndromewind

Raunkiær life formhemicryptophyte

Self fertilizationabsent

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Habitat GIFTmeadows, saline places, steppe

Mycorrhiza typenon-mycorrhizal

Woodinessnon-woody

Physiology & chemistry3

Leaf dry-matter content (LDMC)382 mg/g

Photosynthetic pathwayC3

Seed longevity index0

Other traits1

Diaspore typefruit with appendage

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Carex melanostachya has left across the world's sequence archives.

At a glance

DNA specimens9

Marker genes3

GenBank sequences7

eDNA detections8

Countries3

The DNA barcodea real sequence read deposited for this species

ITSJN634644.1 ↗610 bpAustria

ACGT

CCGTTGCCTTTCCGGAAACACGACCGTCGAACACGTGACAGAATGCTGCCGCGGAGGCGCTCGCCGCCTCCTCGGCCCCACCGGCCTCCT …

Carex melanostachya isolate Mel internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcLa★ITS4

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Carex melanostachya carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size371 640 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Carex melanostachya0.37 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 54 n = 27

Chromosome records54–762n range54median54mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 542×GoaT · Kew Plant DNA C-values Database · CCDB · kew

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · kew — Lipnerová I, Bureš P, Horová L, Šmarda P. 2012. Evolution of genome size in Carex (Cyperaceae) in relation to chromosome number and genomic base composition. Annals of Botany.

2n 761×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Stoeva, M. 2000. Mediterranean chromosome number reports 10 (1213--1226). Fl. Medit. 10: 423–430.

08Occurrence & distribution

Record type5 366 records

Wild obs. + sensor4 297

Museum / vouchered1 022

Other47

Range

Area of Occupancy AOO7 184 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy44% within 1 km

≤100 m 905≤1 km 514≤10 km 1 626>10 km 196

3 241 georeferenced · 1 056 without coordinates

Open the mapobservation + sensor4 297

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy60% within 1 km

≤100 m 141≤1 km 181≤10 km 181>10 km 32

535 georeferenced · 487 without coordinates

Open the institutions mapphysical evidence1 022

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions24 of 45 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Moscow State Universitylocation not on record	366
Wlocation not on record	127
Yerevan, AM	99
GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record	68
BRNUlocation not on record	44
GJOlocation not on record	17
Wuzhou, CN	15
Berlin, DE	12
LDlocation not on record	12
Helsinki, FI	10
BClocation not on record	9
MeiseBGlocation not on record	6
PRClocation not on record	4
BG-NMNHSlocation not on record	4
Chadron, US	4
MAlocation not on record	4
Oskarshamn, SE	4
Montréal, CA	3
Frankfurt am Main	3
GZUlocation not on record	3
Adam Mickiewicz University in Poznańlocation not on record	3
Provincia di Livornolocation not on record	3
Bronx, US	3
Salamanca, ES	3
Urumqi, CN	3
Uniwersytet Śląski w Katowicachlocation not on record	2
Edinburgh, GB	2
Uniwersytet Opolskilocation not on record	2
Görlitz, DE	2
Lincoln, US	2
Austin, US	1
Fort Worth, US	1
Institut und Museum fuer Geologie und Palaeontologielocation not on record	1
Durham, US	1
University of Stellenboschlocation not on record	1
Turku, FI	1
Finnish Museum of Natural Historylocation not on record	1
Oulu, FI	1
Stockholm, SE	1
Ann Arbor, US	1
Samara National Research Universitylocation not on record	1
Columbia, US	1
Kew, GB	1
Brussel, BE	1
SZUlocation not on record	1

45 institutions · 854 of 1 022 vouchered records shown · 168 without an institution code

09Environmental DNA8 detections

Where the DNA of Carex melanostachya was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.0 °C 17.0–17.0

Seasonal swing summer↔winter22.3 °C

Max temp (day)18.9 °C

Min temp (night)15.1 °C

Precipitation60.9 mm/mo

Air humidity60.5 %

Moisture balance-88.1 mm/mo

Vapour deficit767 Pa

Wind speed5.70 m/s

Cloud cover40.0 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Carex melanostachya

At a glance

Sources9 archives

Size & morphology5

Life cycle & reproduction8

Diet & foraging1

Habitat & environment8

Physiology & chemistry3

Other traits1

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Record type5 366 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions24 of 45 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type5 366 records