Carex maritima
Gunnerus · speciesAt a glance
Occurrence records9 587
Data sources7
Biological traits29
DNA specimens96
eDNA detections50
Sources7 archives
Databases and archives Carex maritima's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility9 587 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI50 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics96 specimens↗
NCBIUS National Library of Medicinesequences↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗On this page6 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources29 traits
Occurrence & distributionGBIF9 587 records
Environmental DNA1 datasets · 8 countries50 detections
DNA & barcodingBOLD · NCBI96 specimens
Genome at a glanceCCDB2n = 60
01Narrative
Осо́ка примо́рская, или Осо́ка помо́рская, или Осо́ка щети́нистая, или Осо́ка разноречи́вая — многолетнее травянистое растение, вид рода Осока (Carex) семейства Осоковые (Cyperaceae).
No narrative description available for this taxon yet.
02Traits & measurements
SourcesTRYLEDAGIFTWCVP
Size & morphology8
Leaf size32 mm²
Plant height0.058 m
Plant height max0.15 m
Plant height min0.02 m
Seed length2 mm
Seed mass1.13 mg
Seed mass max1.13 mg
Seed mass min1.12 mg
Life cycle & reproduction7
Dispersal typewater
Flowering endAug
Flowering startJul
Life formperennial or rhizomatous geophyte
Life spanperennial
Raunkiær life formhemicryptophyte
Seed number12.5
Diet & foraging1
Parasiteindependent
Habitat & environment10
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max4 200 m
Elevation min200 m
Epiphyteterrestrial
Growth formherb
⚠ sources differ — GIFT: herb · TRY: Graminoid
Habitat GIFTmountains, shores
Mycorrhiza typearbuscular
Woodinessnon-woody
Physiology & chemistry2
Leaf dry-matter content (LDMC)319 mg/g
Photosynthetic pathwayC3
Other traits1
Diaspore typegenerative dispersule
05DNA & barcoding96 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Carex maritima has left across the world's sequence archives.
At a glance
DNA specimens96
Marker genes10
GenBank sequences10
eDNA detections50
Countries9
The DNA barcodea real sequence read deposited for this species
TCGTTGCCTCTCAAAAACACGACCGTTGCACACGTGACAGAATGCTGTCGGGGAGGTGCTTGCTGCCTCCTCGGCCCCACCGGCCTCGTC …
Carex maritima isolate spm00002500 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK2★rbcL4★rbcLa★ITS4★ITS1★ITS2atpF-atpHpsbK-psbIrpoBrpoC1
plant barcodefungal barcodemarker
06Genome at a glanceCCDB
The complete instruction manual Carex maritima carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 60 n = 30
Chromosome records60–602n range60median60mode10records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 6010×CCDB · nw-europe-fl · CCDB · fl-europaea · CCDB · book-ipcn65 +4
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=4338
CCDB · fl-europaea — Lbve & LOve, 1956
CCDB · book-ipcn65 — Love & Love 1965b
CCDB · ipcn-api-dl — Lövkvist, B. & U. M. Hultgård. 1999. Chromosome numbers in south Swedish vascular plants. Opera Bot. 137: 1–42.
CCDB · ipcn-api-dl — Love, A. & D. Love. 1981c. In Chromosome number reports LXXIII. Taxon 30: 845–851.
CCDB · book-ipcn66 — Love & Ritchie 1966
CCDB · book-ipcn67-71 — JOHNSON, A.W., & J.G. PACKER. 1968. Chromosome numbers in the flora of Ogotruk Creek, N.W. Alaska. Bot. Not. 121: 403-456.
CCDB · book-ipcn67-71 — KNABEN, G., & T. ENGELSKJON. 1967. Chromosome numbers of Scandinavian arctic-alpine plant species. II. Act. Boreal. A. Sci. No. 21: 1-57.
CCDB · book-ipcn67-71 — ZHUKOVA, P.G., & V.V. PETROVSKY. 1971. Chromosome numbers of certain flowering plants of the Wrangel island. (In Russian). Bot. Zurn. 56: 294-305.
CCDB · Cave1956 — Love & Love b
n 301×CCDB · book-ipcn67-71
CCDB · book-ipcn67-71 — KNABEN, G., & T. ENGELSKJON. 1967. Chromosome numbers of Scandinavian arctic-alpine plant species. II. Act. Boreal. A. Sci. No. 21: 1-57.
08Occurrence & distribution
Record type9 587 records
Wild obs. + sensor6 635
Museum / vouchered2 949
Fossil1
Other2
Origin
Native704
Introduced1
Range
Area of Occupancy AOO15 720 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy56% within 1 km
≤100 m 2 215≤1 km 624≤10 km 2 147>10 km 112
5 098 georeferenced · 1 537 without coordinates
Open the mapobservation + sensor6 635
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy65% within 1 km
≤100 m 317≤1 km 599≤10 km 397>10 km 99
1 412 georeferenced · 1 537 without coordinates
Open the institutions mapphysical evidence2 949
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions69 of 150 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 274 |
| TROMlocation not on record | 273 |
| Olocation not on record | 263 |
| LDlocation not on record | 228 |
| Trondheim, NO | 215 |
| South Kensington, GB | 173 |
| Garðabær, IS | 167 |
| 64 | |
| BMlocation not on record | 58 |
| Montréal, CA | 56 |
| Chicago, US | 50 |
| Zürich, CH | 45 |
| Bronx, US | 43 |
| Oskarshamn, SE | 41 |
| Moscow State Universitylocation not on record | 39 |
| Clocation not on record | 39 |
| University of Stellenboschlocation not on record | 38 |
| Bergen, NO | 31 |
| Ann Arbor, US | 31 |
| Uppsala, SE | 31 |
| Chongqing Museumlocation not on record | 28 |
| Zürich, CH | 27 |
| WINlocation not on record | 27 |
| Vancouver, CA | 26 |
| St. Paul, US | 25 |
| KMNlocation not on record | 25 |
| Saint Louis, US | 23 |
| University of Alberta Museumslocation not on record | 19 |
| Québec, CA | 19 |
| Whitehorse, CA | 18 |
| University of Toronto Mississaugalocation not on record | 17 |
| Victoria, CA | 16 |
| Madison, US | 16 |
| Toronto, CA | 16 |
| Yukon Universitylocation not on record | 16 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 15 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 13 |
| BSBIlocation not on record | 12 |
| Montréal, CA | 12 |
| Anchorage, US | 11 |
| NMWlocation not on record | 11 |
| Oulu, FI | 10 |
| Manchester Museum, University of Manchesterlocation not on record | 10 |
| WTUlocation not on record | 10 |
| Kandalaksha State Nature Reservelocation not on record | 9 |
| GINRlocation not on record | 9 |
| Acadia Universitylocation not on record | 9 |
| Canadian Museum of Naturelocation not on record | 9 |
| Bern, CH | 8 |
| SLU Artdatabankenlocation not on record | 7 |
| Auckland, NZ | 6 |
| San Isidro, AR | 5 |
| BM|NMWlocation not on record | 5 |
| Trois-Rivières, CA | 5 |
| University of Birminghamlocation not on record | 5 |
| Wlocation not on record | 5 |
| University of Winnipeglocation not on record | 5 |
| Tromso University Museumlocation not on record | 5 |
| Elocation not on record | 4 |
| Churchill Northern Studies Centrelocation not on record | 4 |
| Missoula, US | 4 |
| Provo, US | 4 |
| Glasgow University Herbariumlocation not on record | 4 |
| B.A. Bennett Herbariumlocation not on record | 4 |
| Université Lavallocation not on record | 4 |
| Copenhagen, DK | 4 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 4 |
| Cambridge University Herbariumlocation not on record | 3 |
| Jyväskylä, FI | 3 |
| Oregon State Universitylocation not on record | 3 |
| Christchurch, NZ | 3 |
| Kuopio, FI | 3 |
| Uniwersytet Śląski w Katowicachlocation not on record | 3 |
| Canadian Museum of Nature, Natural Heritage Buildinglocation not on record | 3 |
| University of Helsinkilocation not on record | 3 |
| Dresden, DE | 2 |
| BIRM|BM|MANCH|NMWlocation not on record | 2 |
| BM|CGElocation not on record | 2 |
| Kew, GB | 2 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 2 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 2 |
| CJBGlocation not on record | 2 |
| Tampa, US | 2 |
| Helsinki, FI | 2 |
| Davis, US | 2 |
| Claremont, US | 2 |
| UChlocation not on record | 2 |
| Berlin, DE | 2 |
| Irkutsk State Universitylocation not on record | 2 |
| Adam Mickiewicz University in Poznańlocation not on record | 2 |
| ASUlocation not on record | 2 |
| BClocation not on record | 2 |
| nbflocation not on record | 2 |
| Göteborg, SE | 2 |
| Lake Placid, US | 2 |
| Paris, FR | 2 |
| BIRM|BMlocation not on record | 1 |
| BM|Elocation not on record | 1 |
| North Carolina Museum of Natural Scienceslocation not on record | 1 |
| Herbarium of the Department of Botany, University of Tokyolocation not on record | 1 |
| Royal Botanic Garden Edinburghlocation not on record | 1 |
| Barcelona, ES | 1 |
| NMBU:MINAlocation not on record | 1 |
| Córdoba, AR | 1 |
| Philadelphia, US | 1 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 1 |
| National Museum Waleslocation not on record | 1 |
| New Haven, US | 1 |
| BM|Klocation not on record | 1 |
| Stockholm, SE | 1 |
| Logan, US | 1 |
| NMW|PTHlocation not on record | 1 |
| Rovaniemi, FI | 1 |
| Davenport, US | 1 |
| Karlsruhe, DE | 1 |
| BM|HDD|MANCHlocation not on record | 1 |
| Moscow, US | 1 |
| BM|MANCHlocation not on record | 1 |
| ABS|BM|CGElocation not on record | 1 |
| New Brunswick, US | 1 |
| Pullman, US | 1 |
| University of St Andrews Herbariumlocation not on record | 1 |
| San Diego, US | 1 |
| Aarhus, DK | 1 |
| PVTlocation not on record | 1 |
| BIRM|BM|CGElocation not on record | 1 |
| Williamsburg, US | 1 |
| Tolson Memorial Museumlocation not on record | 1 |
| Wellington, NZ | 1 |
| BIRM|NMWlocation not on record | 1 |
| Boise, US | 1 |
| Flagstaff, US | 1 |
| La Paz, BO | 1 |
| Provincia di Livornolocation not on record | 1 |
| Salamanca, ES | 1 |
| Sion, CH | 1 |
| BIO-UNIPIlocation not on record | 1 |
| San Angelo, US | 1 |
| BM|GLlocation not on record | 1 |
| University of Western Ontariolocation not on record | 1 |
| University of Oxfordlocation not on record | 1 |
| Xiamen, CN | 1 |
| DBF-NHMDlocation not on record | 1 |
| BM|RNGlocation not on record | 1 |
| BRNUlocation not on record | 1 |
| BioFokuslocation not on record | 1 |
| Görlitz, DE | 1 |
| Bloomington, US | 1 |
| ABS|BMlocation not on record | 1 |
| BM|MANCH|NMWlocation not on record | 1 |
150 institutions · 2 829 of 2 949 vouchered records shown · 115 without an institution code
09Environmental DNA50 detections
Where the DNA of Carex maritima was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found50
Studies independent surveys1
Countries8
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 50 detections have coordinates
Open the map8 countries0
Old beach ridge, in plately sand.Base of cliff, dominating small sand dune.Neutral aspect, moist saline alluvium, commo…Throughout north shore of lake in dunes on o…Dry Temporal Pool
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median8.60 °C 2.10–10.8
Seasonal swing summer↔winter31.3 °C
Max temp (day)11.8 °C 2.10–15.0
Min temp (night)6.10 °C -1.50–8.10
Precipitation74.2 mm/mo 35.1–102
Air humidity61.9 % 55.4–67.4
Moisture balance-9.30 mm/mo -51.9–48.7
Vapour deficit441 Pa 300–514
Wind speed4.40 m/s 2.50–5.60
Cloud cover56.9 % 44.1–73.5
CHELSA 1981–2010, ~9 km grid, at location & month of 32 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.