Carex mariposana

L.H.Bailey ex Mack. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Cyperaceae/Carex

At a glance

Occurrence records197

Data sources8

Biological traits90

DNA specimens5

eDNA detections5

Sources8 archives

Databases and archives Carex mariposana's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility197 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources90 traits

Occurrence & distributionGBIF197 records

Environmental DNA1 datasets · 1 countries5 detections

DNA & barcodingBOLD · NCBI5 specimens

01Narrative

Carex mariposana is a species of sedge known by the common name Mariposa sedge.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTUSDATRY

Size & morphology1

Plant height0.61 m

Life cycle & reproduction25

After harvest regrowth rateSlow

Bloom periodSpring

Coppice potentialNo

Flower colouryellow

Flower conspicuousNo

Fruit seed period beginSpring

Fruit seed period endSummer

Growth rate USDASlow

Life formperennial or rhizomatous geophyte

Life spanperennial

Lifeform raunkiaer detailedgeophyte

Lifespan categoryModerate

Propagated by bare rootNo

Propagated by bulbNo

Propagated by containerNo

Propagated by cormNo

Propagated by cuttingsNo

Propagated by seedYes

Propagated by sodNo

Propagated by sprigsYes

Propagated by tubersNo

Resprout abilityNo

Seed spread rateSlow

Seedling vigorLow

Vegetative spread rateNone

Diet & foraging1

Parasiteindependent

Habitat & environment24

Active growth periodSpring and Summer

Adapted to coarse textured soilsYes

Adapted to fine textured soilsNo

Adapted to medium textured soilsYes

Aquaticterrestrial

BloatNone

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Foliage colorGreen

Foliage porosity summerPorous

Foliage porosity winterPorous

Foliage textureMedium

Fruit colourbrown

Growth formherb

⚠ sources differ — GIFT: herb · TRY: Graminoid

Growth form USDABunch

Hedge toleranceNone

Known allelopathNo

Leaf retentionNo

Low growing grassNo

Root depth min9 in

Shape and orientationErect

Small grainNo

Woodinessnon-woody

Physiology & chemistry19

Anaerobic toleranceLow

C:N ratioMedium

Caco3 toleranceLow

Cold stratification requiredYes

Drought toleranceHigh

Fertility requirementLow

Fire resistantNo

Fire toleranceHigh

Frost free days min130 days

Moisture useLow

Nitrogen fixation levelNone

Precipitation max60 in

Precipitation min14 in

Protein potentialLow

Salinity toleranceNone

Shade toleranceLow

Soil pH max7.7 pH

Soil pH min6 pH

Temperature min-13 °F

Uses & economy14

Berry nut seed productNo

Christmas tree productNo

Commercial availabilityNo Known Source

Fodder productNo

Lumber productNo

Naval store productNo

Nursery stock productNo

Palatable browse animalLow

Palatable graze animalLow

Palatable humanNo

Post productNo

Pulpwood productNo

ToxicityNone

Veneer productNo

Other traits6

Fall conspicuousNo

Fruit seed abundanceLow

Fruit seed conspicuousNo

Fruit seed persistenceNo

Planting density max18 000 per acre

Planting density min11 000 per acre

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Carex mariposana has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes4

GenBank sequences4

eDNA detections5

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMN762770.1 ↗542 bpUSA

ACGT

TTGCCTCTCGAAAAACACGACCTTGAAGGCGTGACAGAATGCTGTCGGGGAGGTGCTTGTTGCCTCTTGGTCCCACCGGCCTCGTCCCTC …

Carex mariposana isolate spm00002499 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcLa★ITS4★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type197 records

Museum / vouchered197

Range

Area of Occupancy AOO480 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy73% within 1 km

≤100 m 2≤1 km 38≤10 km 15

55 georeferenced · 142 without coordinates

Open the institutions mapphysical evidence197

10Collections & institutions

Holding institutions19 of 28 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Claremont, US	28
Ann Arbor, US	26
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	15
CASlocation not on record	14
Arcata, US	9
Riverside, US	9
Museum of the Rockieslocation not on record	9
WTUlocation not on record	7
Flagstaff, US	6
Fredericton Stock Culture Collectionlocation not on record	6
Davis, US	5
Angwin, US	5
San Diego, US	4
Pullman, US	3
Dover, US	3
Northridge, US	2
University of Stellenboschlocation not on record	2
Severin-McDaniel Insect Collectionlocation not on record	2
Delaware State University, Claude E. Phillips Herbariumlocation not on record	2
Phoenix, US	1
Guasave, MX	1
San Angelo, US	1
Henderson, US	1
Chongqing Museumlocation not on record	1
San Luis Obispo, US	1
Bloomington, US	1
Santa Barbara, US	1
Taipei, TW	1

28 institutions · 166 of 197 vouchered records shown · 31 without an institution code

09Environmental DNA5 detections

Where the DNA of Carex mariposana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.6 °C 13.2–14.0

Seasonal swing summer↔winter19.9 °C

Max temp (day)20.9 °C 19.8–21.9

Min temp (night)6.20 °C 6.00–6.30

Precipitation20.1 mm/mo 19.0–21.1

Air humidity44.6 % 43.0–46.2

Moisture balance-144 mm/mo -145–-143

Vapour deficit864 Pa 817–910

Wind speed3.00 m/s 2.30–3.60

Cloud cover13.4 % 12.1–14.8

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)