Carex maorica

Hamlin · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Cyperaceae/Carex

At a glance

Occurrence records552

Data sources7

Biological traits29

DNA specimens0

eDNA detections0

Sources7 archives

Databases and archives Carex maorica's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility552 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources29 traits

Occurrence & distributionGBIF552 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 72

01Narrative

Carex maorica adalah spesies tumbuhan seperti rumput yang tergolong ke dalam famili Cyperaceae. Spesies ini juga merupakan bagian dari ordo Poales. Spesies Carex maorica sendiri merupakan bagian dari genus Carex. Nama ilmiah dari spesies ini pertama kali diterbitkan oleh Hamlin.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology12

Leaf length max1 000 mm

Leaf width5 mm

Leaf width max5 mm

Leaf width min5 mm

Plant height0.4 m

Plant height max0.7 m

Seed length2 mm

Seed length max2 mm

Seed length min2 mm

Seed mass0.811 mg

Seed mass max0.81 mg

Seed mass min0.81 mg

Life cycle & reproduction9

Deciduousnessevergreen

Dispersal typeunspecialized

Life formperennial or rhizomatous geophyte

Life spanperennial

Pollination modeabiotic

Pollination syndromewind

Raunkiær life formhemicryptophyte

Reproduction asexualpresent

Sex typemonoecious

Diet & foraging1

Parasiteindependent

Habitat & environment6

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Habitat GIFTLowland

Woodinessnon-woody

Other traits1

Plant support typefree-standing

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Carex maorica has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSAY699619.1 ↗713 bpNew Zealand

ACGT

GGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGTTGCCTTTCCAGAAACACGACCGTCGAACACGTGACA …

Carex maorica isolate 00603A 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Carex maorica carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 72 n = 36

Chromosome records72–762n range74median72mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 721×CCDB · new-zealand

CCDB · new-zealand

2n 731×CCDB · new-zealand

CCDB · new-zealand

2n 741×CCDB · new-zealand

CCDB · new-zealand

2n 751×CCDB · new-zealand

CCDB · new-zealand

2n 761×CCDB · new-zealand

CCDB · new-zealand

08Occurrence & distribution

Record type552 records

Wild obs. + sensor185

Museum / vouchered367

Origin

Native1

Range

Area of Occupancy AOO1 752 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy69% within 1 km

≤100 m 79≤1 km 24≤10 km 38>10 km 8

149 georeferenced · 36 without coordinates

Open the mapobservation + sensor185

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy57% within 1 km

≤100 m 12≤1 km 8≤10 km 14>10 km 1

35 georeferenced · 332 without coordinates

Open the institutions mapphysical evidence367

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Christchurch, NZ	234
Auckland, NZ	83
Rotorua, NZ	25
Wellington, NZ	10
Hobart, AU	4
Kew, GB	3
Museo Entomologico de Leonlocation not on record	2
Canberra, AU	2
Mount Annan, AU	1
Montréal, CA	1
Guangzhou, CN	1
Palmerston North, NZ	1

12 institutions · 367 of 367 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)