Carex luzulifolia

W.Boott · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Cyperaceae/Carex

At a glance

Occurrence records122

Data sources6

Biological traits14

DNA specimens4

eDNA detections4

Sources6 archives

Databases and archives Carex luzulifolia's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility122 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources14 traits

Occurrence & distributionGBIF122 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD · NCBI4 specimens

01Narrative

Carex luzulifolia adalah spesies tumbuhan seperti rumput yang tergolong ke dalam famili Cyperaceae. Spesies ini juga merupakan bagian dari ordo Poales. Spesies Carex luzulifolia sendiri merupakan bagian dari genus Carex. Nama ilmiah dari spesies ini pertama kali diterbitkan oleh W.Boott.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology3

Seed mass0.491 mg

Seed mass max0.491 mg

Seed mass min0.491 mg

Life cycle & reproduction3

Life formperennial or rhizomatous geophyte

Life spanperennial

Lifeform raunkiaer detailedgeophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Other traits1

Plant support typefree-standing

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Carex luzulifolia has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes4

GenBank sequences3

eDNA detections4

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMK581339.1 ↗611 bpUSA

ACGT

TCGTTGCCTTTCCAAAAACACGACCGTCGAACACGTGACAGAATGCTGCCGCGGAGGCGCTTGCCGCCTCCTAGGCCCCACCGGCCTCCT …

Carex luzulifolia isolate B410 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcLa★ITS3★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type122 records

Wild obs. + sensor11

Museum / vouchered111

Range

Area of Occupancy AOO324 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 6

6 georeferenced · 5 without coordinates

Open the mapobservation + sensor11

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy67% within 1 km

≤100 m 5≤1 km 45≤10 km 24>10 km 1

75 georeferenced · 36 without coordinates

Open the institutions mapphysical evidence111

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions19 of 25 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	16
Davis, US	15
Moscow, US	7
Angwin, US	6
Pullman, US	5
Fredericton Stock Culture Collectionlocation not on record	4
CASlocation not on record	4
US	3
Arcata, US	3
San Luis Obispo, US	3
Ann Arbor, US	3
Flagstaff, US	2
Albuquerque, US	1
San Angelo, US	1
Claremont, US	1
Chicago, US	1
Caldwell, US	1
Logan, US	1
San Diego, US	1
WTUlocation not on record	1
University of Stellenboschlocation not on record	1
Delaware State University, Claude E. Phillips Herbariumlocation not on record	1
Mississippi State, US	1
Truckee, US	1
Santa Barbara, US	1

25 institutions · 84 of 111 vouchered records shown · 27 without an institution code

09Environmental DNA4 detections

Where the DNA of Carex luzulifolia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.0 °C 17.0–17.0

Seasonal swing summer↔winter20.5 °C

Max temp (day)25.2 °C

Min temp (night)9.70 °C

Precipitation10.9 mm/mo

Air humidity43.0 %

Moisture balance-149 mm/mo

Vapour deficit1,105 Pa

Wind speed2.20 m/s

Cloud cover13.9 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)