Carex lucorum

Willd. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Cyperaceae/Carex

At a glance

Occurrence records136

Data sources7

Biological traits10

DNA specimens4

eDNA detections5

Sources7 archives

Databases and archives Carex lucorum's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility136 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources10 traits

Occurrence & distributionGBIF136 records

Environmental DNA1 datasets · 1 countries5 detections

DNA & barcodingBOLD · NCBI4 specimens

Genome at a glanceCCDB2n = 40

01Narrative

Carex lucorum adalah spesies tumbuhan seperti rumput yang tergolong ke dalam famili Cyperaceae. Spesies ini juga merupakan bagian dari ordo Poales. Spesies Carex lucorum sendiri merupakan bagian dari genus Carex. Nama ilmiah dari spesies ini pertama kali diterbitkan oleh Willd..

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Life cycle & reproduction3

Life formperennial or rhizomatous geophyte

Life spanperennial

Lifeform raunkiaer detailedgeophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

⚠ sources differ — GIFT: herb · TRY: Graminoid

Woodinessnon-woody

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Carex lucorum has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes4

GenBank sequences7

eDNA detections5

Countries2

The DNA barcodea real sequence read deposited for this species

ITSAY325464.1 ↗613 bp

ACGT

TTGCCTTTCCGAAAACACGACCGTCGAACACGTGACAGAATGCTGCCGCGGAGGCGCCTGCCGCCTCCTCGGCCCCACCGGCCTCCTCCT …

Carex lucorum var. lucorum internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL3★rbcLa★ITS3

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Carex lucorum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 40 n = 20

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

n 201×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Crins, W. J. & P. W. Ball. 1983. The taxonomy of the Carex pensylvanica complex (Cyperaceae) in North America. Canad. J. Bot. 61: 1692–1717.

08Occurrence & distribution

Record type136 records

Wild obs. + sensor99

Museum / vouchered37

Range

Area of Occupancy AOO500 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 68≤1 km 6≤10 km 2>10 km 3

79 georeferenced · 20 without coordinates

Open the mapobservation + sensor99

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy56% within 1 km

≤100 m 3≤1 km 6≤10 km 7

16 georeferenced · 21 without coordinates

Open the institutions mapphysical evidence37

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Madison, US	14
Saint John, CA	6
Montréal, CA	4
St. Paul, US	2
Miami, US	2
Montréal, CA	2
Québec, CA	1
EL PASO, US	1
Trois-Rivières, CA	1
Kew, GB	1
McGill University, Herbariumlocation not on record	1
Auckland, NZ	1

12 institutions · 36 of 37 vouchered records shown · 1 without an institution code

09Environmental DNA5 detections

Where the DNA of Carex lucorum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.8 °C 18.8–18.8

Seasonal swing summer↔winter30.4 °C

Max temp (day)23.6 °C

Min temp (night)13.9 °C

Precipitation103 mm/mo

Air humidity57.4 %

Moisture balance-44.2 mm/mo

Vapour deficit922 Pa

Wind speed3.70 m/s

Cloud cover48.0 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)