Carex longifructus

(Kük.) K.A.Ford · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Cyperaceae/Carex

At a glance

Occurrence records131

Data sources5

Biological traits8

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Carex longifructus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility131 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources8 traits

Occurrence & distributionGBIF131 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 88

01Narrative

Uncinia longifructus là loài thực vật có hoa trong họ Cói. Loài này được (Kük.) Petrie miêu tả khoa học đầu tiên năm 1919 publ. 1920.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formperennial

Raunkiær life formhemicryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment5

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Carex longifructus has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

Countries1

The DNA barcodea real sequence read deposited for this species

matKMN763397.1 ↗606 bpNew Zealand

ACGT

AGAAATCGGTTTCTATATTCTCAAAAGAAAATATAAGACTCTCTCGTTTCTTATATAATTCTTATGTATCAGAATATGAGTTTTTATTCC …

Carex longifructus isolate spm00004426 maturase K (matK) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Carex longifructus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 88 n = 44

Chromosome records88–882n range88median88mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 883×CCDB · new-zealand · CCDB · cyper-only · CCDB · book-ipcn67-71

CCDB · new-zealand

CCDB · cyper-only — Beuzenberg, E. J.1970

CCDB · book-ipcn67-71 — BEUZENBERG, E.J. 1970. Contributions to a chromosome atlas of the New Zealand flora. 14. Uncinia (Cyperaceae). New Zealand J. Bot. 8: 260-263.

08Occurrence & distribution

Record type131 records

Wild obs. + sensor44

Museum / vouchered87

Range

Area of Occupancy AOO308 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy2% within 1 km

≤100 m 1≤10 km 42>10 km 1

44 georeferenced

Open the mapobservation + sensor44

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 87 records without

Open the institutions mapphysical evidence87

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Christchurch, NZ	66
Wellington, NZ	20
Rotorua, NZ	1

3 institutions · 87 of 87 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)