Carex limosa
speciesAt a glance
Occurrence records79 298
Data sources12
Biological traits117
DNA specimens52
eDNA detections46
Sources12 archives
Databases and archives Carex limosa's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility79 281 records↗
OBISOcean Biodiversity Information System17 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI46 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics52 specimens↗
NCBIUS National Library of Medicinesequences↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
Paleobiology DatabasePBDB consortiumfossil record↗
WikidataWikimedia Foundationstructured facts↗On this page6 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources117 traits
Occurrence & distributionGBIF · OBIS79 298 records
Environmental DNA2 datasets · 8 countries46 detections
DNA & barcodingBOLD · NCBI52 specimens
Genome at a glanceCCDB · GoaT538 Mbp
01Narrative
Carex limosa est une espèce de plantes du genre Carex et de la famille des Cyperaceae. Cette espèce est appelée « Laîche des bourbiers », « Laîche des tourbières » ou encore « Laîche des vases ». C'est une plante aquatique ou de rivage. On la retrouve le plus souvent dans les marais ou les tourbières de montagne. Elle se répartit à travers l'Amérique du Nord et l'Eurasie. Le carex limosa a un grand rhizome et des racines velues. La tige mesure en général à peu près 50 centimètres et possède quelques feuilles à sa base. Le bout de la tige est souvent occupé par un épillet staminé, et au-dessous de celui-ci un ou plusieurs épillets pistillés, et quelques épillets peuvent avoir les pièces masculines et femelles à la fois. Carex limosa est une espèce protégée sur l'ensemble du territoire français par arrêté du 20 janvier 1982.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTLEDAUSDATRYWCVP
Size & morphology10
Leaf mass3.41 mg
Leaf size316 mm²
⚠ sources differ — TRY: 316 mm² · LEDA: 90.5 mm² · GIFT: 90.5 mm²
Plant height0.438 m
⚠ sources differ — GIFT: 0.438 m · LEDA: 0.325 m · USDA: 0.549 m · TRY: 0.401 m
Plant height generative0.325 m
Plant height max0.5 m
Plant height min0.15 m
Seed length2.91 mm
Seed mass1.65 mg
⚠ sources differ — TRY: 1.65 mg · LEDA: 1.76 mg · GIFT: 1.63 mg
Seed mass max1.75 mg
Seed mass min1.42 mg
Life cycle & reproduction35
After harvest regrowth rateSlow
Bloom periodLate Spring
Coppice potentialNo
Deciduousnessn.d.
⚠ sources differ — TRY: n.d. · GIFT: evergreen
Dehiscenceindehiscent
Dispersal typewater
Flower colourgreen
Flower conspicuousNo
Flowering endJul
Flowering startMay
Fruit seed period beginSpring
Fruit seed period endSummer
Growth rate USDASlow
Life formperennial or rhizomatous geophyte
Life spanperennial
Lifespan categoryLong
Pollination modeabiotic
Pollination syndromewind
Propagated by bare rootYes
Propagated by bulbNo
Propagated by containerNo
Propagated by cormNo
Propagated by cuttingsNo
Propagated by seedYes
Propagated by sodNo
Propagated by sprigsYes
Propagated by tubersNo
Raunkiær life formhemicryptophyte
Reproduction asexualabsent
Resprout abilityNo
Seed number16
Seed spread rateSlow
Seedling vigorLow
Self fertilizationabsent
Vegetative spread rateRapid
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment27
Active growth periodSpring and Summer
Adapted to coarse textured soilsYes
Adapted to fine textured soilsNo
Adapted to medium textured soilsYes
Aquaticterrestrial
BloatNone
Climatetemperate
Climberself-supporting
Epiphyteterrestrial
Foliage colorGreen
Foliage porosity summerPorous
Foliage porosity winterPorous
Foliage textureFine
Fruit colourbrown
Fruit typeachene
Growth formherb
⚠ sources differ — GIFT: herb · TRY: graminoid
Growth form USDARhizomatous
Habitat GIFTmeadows: wet
Hedge toleranceNone
Known allelopathNo
Leaf retentionNo
Low growing grassNo
Mycorrhiza typenon-mycorrhizal
Root depth min8 in
Shape and orientationErect
Small grainNo
Woodinessnon-woody
Physiology & chemistry22
Anaerobic toleranceHigh
C:N ratioMedium
Caco3 toleranceMedium
Cold stratification requiredYes
Drought toleranceNone
Fertility requirementLow
Fire resistantNo
Fire toleranceHigh
Frost free days min85 days
Leaf dry-matter content (LDMC)310 mg/g
Moisture useMedium
Nitrogen fixation levelNone
Photosynthetic pathwayC3
Precipitation max46 in
Precipitation min14 in
Protein potentialLow
Salinity toleranceNone
Shade toleranceHigh
Soil pH max7.5 pH
Soil pH min4.8 pH
Specific leaf area (SLA)23.67 mm²/mg
Temperature min-33 °F
Uses & economy14
Berry nut seed productNo
Christmas tree productNo
Commercial availabilityNo Known Source
Fodder productNo
Lumber productNo
Naval store productNo
Nursery stock productNo
Palatable browse animalLow
Palatable graze animalLow
Palatable humanNo
Post productNo
Pulpwood productNo
ToxicityNone
Veneer productNo
Other traits7
Diaspore typeone-seeded generative dispersule
Fall conspicuousNo
Fruit seed abundanceLow
Fruit seed conspicuousNo
Fruit seed persistenceNo
Planting density max4 800 per acre
Planting density min1 700 per acre
05DNA & barcoding52 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Carex limosa has left across the world's sequence archives.
At a glance
DNA specimens52
Marker genes6
GenBank sequences10
eDNA detections46
Countries9
The DNA barcodea real sequence read deposited for this species
TGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGACCCTCCCGAGGGCACGCCTGCCTCATGGGCGTTAGAAG …
Carex limosa voucher B0419 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK1★rbcL4★rbcLa★trnL-F★ITS5★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB · GoaT
The complete instruction manual Carex limosa carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size537 900 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Carex limosa0.54 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 64 n = 32
Chromosome records56–642n range64median64mode34records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 6418×CCDB · fl-europaea · CCDB · book-ipcn65 · CCDB · cyper-only +3
CCDB · fl-europaea — Wulff, 1939
CCDB · book-ipcn65 — Love & Love 1965h
CCDB · cyper-only — Wulff, H. D.1939
CCDB · cyper-only — Lve, . & D. Lve 1965a
CCDB · cyper-only — Lve, . & J. C. Ritchie1966
CCDB · cyper-only — Lve, . & D. Lve1981
CCDB · cyper-only — Lve, . & D. Lve1982b
CCDB · cyper-only — Druskovic, L. P.1995
CCDB · ipcn-api-dl — Löve, A. & D. Löve. 1982. IOPB chromosome number reports LXXVII. Taxon 31: 766–768.
CCDB · ipcn-api-dl — Druskovic, B. 1995. IOPB chromosome data 9. Int. Organ. Pl. Biosyst. Newslett. (Zurich) 24: 11–14.
CCDB · ipcn-api-dl — Cayouette, J. 1997. IOPB chromosome data 12. Newslett. Int. Organ. Pl. Biosyst. (Oslo) 28: 13–14.
CCDB · ipcn-api-dl — Love, A. & D. Love. 1981c. In Chromosome number reports LXXIII. Taxon 30: 845–851.
CCDB · book-ipcn66 — Love & Ritchie 1966
CCDB · CromoCat 2015 — Cayouette, J. (1997). IOPB Chromosome Data 12 (ed. C.A. Stace). Int. Organ. Pl. Biosyst. Newslett. 28: 13-14.
CCDB · CromoCat 2015 — Druskovic, B. (1995). IOPB Chromosome Data 9 (ed. C.A. Stace). Int. Organ. Pl. Biosyst. Newslett. 24: 11-14.
CCDB · CromoCat 2015 — Löve, A. & Löve, D. (1965a). Reports [In Löve, A. & O. T. Solbrig (eds.) IOPB chromosome numbers reports III]. Taxon 14(1): 50-57.
CCDB · CromoCat 2015 — Löve, A. & Löve, D. (1981a). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXXIII]. Taxon 30(4): 845-851.
CCDB · CromoCat 2015 — Löve, A. & Löve, D. (1982d). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXXVII]. Taxon 31(4): 766-768.
2n 569×CCDB · cyper-only · CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · cyper-only — Tanaka, N.1942i
CCDB · cyper-only — Tanaka, N.1948
CCDB · cyper-only — Zhukova, P. G. & V. V. Petrovsky1975
CCDB · cyper-only — Krogulevich, R. E.1976
CCDB · cyper-only — Zhukova, P. G. & V. V. Petrovsky1976
CCDB · ipcn-api-dl — Krogulevich, R. E. 1976. Rol poliploidii v genesise flory Putorana. In: L. I. Malyshev, ed. 1976 Flora Putorana: Materali k Poznaniiu Osobennostei Sostava i Genezisia Gornykh Subarkticheskikh Flor Sibir. Novosibirsk. Nauka, Novosibirsk
CCDB · ipcn-api-dl — ZHUKOVA, P. G. & V. V. Petrovsky. 1975. Chromosome numbers of some Western Chukolka plant species. Bot. Žhurn. (Moscow & Leningrad) 60(3): 395–401.
CCDB · ipcn-api-dl — ZHUKOVA, P. G. & V. V. Petrovsky. 1976. Chromosome numbers of some Western Chukolka plant species, II. Bot. Žhurn. (Moscow & Leningrad) 61(7): 963–969.
CCDB · CromoCat 2015 — Krogulevich, R. E. (1976a). Rol poliploidii v genesise flory Putorana. In: Flora Putorana, NS.
2n 585×GoaT · Kew Plant DNA C-values Database · CCDB · cyper-only · CCDB · book-ipcn67-71 +2
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · cyper-only — Knaben, G. & T. Engelskjon1967
CCDB · book-ipcn67-71 — KNABEN, G., & T. ENGELSKJON. 1967. Chromosome numbers of Scandinavian arctic-alpine plant species. II. Act. Boreal. A. Sci. No. 21: 1-57.
CCDB · kew — Lipnerová I, Bureš P, Horová L, Šmarda P. 2012. Evolution of genome size in Carex (Cyperaceae) in relation to chromosome number and genomic base composition. Annals of Botany.
CCDB · CromoCat 2015 — Rotreklová, O. & Bureš, P. & ?epka, R. & Grulich, V. & Šmarda, P. & Hralová, I. & Zedek, F.& Koutecký, T. (2011). Chromosome numbers of Carex Preslia 83: 25–58
2n 622×CCDB · cyper-only · CCDB · Cave1956
CCDB · cyper-only — Lve, . & D. Lve1956
CCDB · Cave1956 — Love & Love b
2n 611×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Gervais, C. & Cayouette, J. (1985). Liste annotée de nombres chromosomiques de la flore vasculaire du nord-est de l'Amerique IV. Le Naturaliste Canadien 112: 319-331
2n 631×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Gervais, C. & Cayouette, J. (1985). Liste annotée de nombres chromosomiques de la flore vasculaire du nord-est de l'Amerique IV. Le Naturaliste Canadien 112: 319-331
08Occurrence & distribution
Record type79 298 records
Wild obs. + sensor66 959
Museum / vouchered12 044
Cultivated / captive36
Fossil1
Other258
Origin
Native2 668
Range
Area of Occupancy AOO147 104 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy63% within 1 km
≤100 m 21 318≤1 km 15 411≤10 km 20 681>10 km 1 121
58 531 georeferenced · 8 428 without coordinates
Open the mapobservation + sensor66 959
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy39% within 1 km
≤100 m 776≤1 km 2 286≤10 km 2 903>10 km 1 901
7 866 georeferenced · 4 178 without coordinates
Open the institutions mapphysical evidence12 044
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
>10 km 2
2 georeferenced · 34 without coordinates
Open the mapnot free-living36
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions131 of 248 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 1 083 |
| Helsinki, FI | 988 |
| Olocation not on record | 637 |
| Uppsala, SE | 634 |
| LDlocation not on record | 561 |
| Moscow State Universitylocation not on record | 531 |
| Trondheim, NO | 442 |
| South Kensington, GB | 303 |
| Oulu, FI | 276 |
| Université Lavallocation not on record | 215 |
| BFLlocation not on record | 212 |
| TROMlocation not on record | 204 |
| Tartu, EE | 169 |
| St. Paul, US | 166 |
| Kuopio, FI | 152 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 150 |
| Madison, US | 149 |
| Québec, CA | 149 |
| Bergen, NO | 147 |
| Turku, FI | 145 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 142 |
| Salzburg, AT | 142 |
| SLU Artdatabankenlocation not on record | 138 |
| Garðabær, IS | 137 |
| Bronx, US | 136 |
| Oskarshamn, SE | 136 |
| Toronto, CA | 125 |
| TUR-Alocation not on record | 100 |
| KMNlocation not on record | 91 |
| Ann Arbor, US | 91 |
| Adam Mickiewicz University in Poznańlocation not on record | 90 |
| MeiseBGlocation not on record | 87 |
| 77 | |
| Provincia di Livornolocation not on record | 73 |
| Chicago, US | 73 |
| Irkutsk State Universitylocation not on record | 69 |
| University of Alberta Museumslocation not on record | 68 |
| Jyväskylä, FI | 64 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 61 |
| BRNUlocation not on record | 61 |
| Vancouver, CA | 58 |
| Philadelphia, US | 54 |
| WTUlocation not on record | 51 |
| Bern, CH | 49 |
| WINlocation not on record | 48 |
| Moscow, US | 47 |
| Montréal, CA | 45 |
| Tallinn, EE | 45 |
| Montréal, CA | 42 |
| Odawara, JP | 42 |
| Missoula, US | 41 |
| LfUlocation not on record | 40 |
| Tomioka, JP | 40 |
| University of Hamburglocation not on record | 38 |
| Görlitz, DE | 37 |
| Shinshu Universitylocation not on record | 37 |
| GJOlocation not on record | 34 |
| University of Toronto Mississaugalocation not on record | 32 |
| Chongqing Museumlocation not on record | 32 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 32 |
| Kandalaksha State Nature Reservelocation not on record | 32 |
| Acadia Universitylocation not on record | 31 |
| Victoria, CA | 31 |
| Burlington, US | 29 |
| University of New Hampshirelocation not on record | 26 |
| Brussel, BE | 25 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 24 |
| Provo, US | 24 |
| SZUlocation not on record | 23 |
| Zürich, CH | 22 |
| Wlocation not on record | 21 |
| Zürich, CH | 21 |
| Yukon Universitylocation not on record | 21 |
| Saint John, CA | 20 |
| University of Stellenboschlocation not on record | 20 |
| CJBGlocation not on record | 20 |
| Green Bay, US | 19 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 19 |
| Tsukuba, JP | 18 |
| KFGBlocation not on record | 17 |
| Corvallis, US | 16 |
| Pullman, US | 16 |
| Sendai, JP | 16 |
| Uniwersytet Śląski w Katowicachlocation not on record | 15 |
| JP | 15 |
| Bloomington, US | 15 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 14 |
| Hokkaido University Botanic Gardenlocation not on record | 14 |
| Durham, US | 14 |
| Porrentruy, CH | 14 |
| Toyama, JP | 13 |
| New Haven, US | 13 |
| Saint Louis, US | 13 |
| Denver, US | 12 |
| MAlocation not on record | 12 |
| PRClocation not on record | 12 |
| Mlocation not on record | 11 |
| Tampa, US | 11 |
| Nagano City, JP | 11 |
| Lincoln, US | 11 |
| Christchurch, NZ | 11 |
| Frankfurt am Main | 11 |
| Porvoo, FI | 10 |
| IWEP FEB RASlocation not on record | 10 |
| University of Birminghamlocation not on record | 10 |
| Flagstaff, US | 10 |
| Hamilton, US | 9 |
| Auckland, NZ | 9 |
| Bozeman, US | 9 |
| Karlsruhe, DE | 9 |
| McWane Science Centerlocation not on record | 9 |
| Claremont, US | 9 |
| Davis, US | 9 |
| DBF-NHMDlocation not on record | 8 |
| Rovaniemi, FI | 8 |
| Oregon State Universitylocation not on record | 8 |
| Stockholm, SE | 8 |
| SIHUlocation not on record | 8 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 8 |
| Whitehorse, CA | 8 |
| Sanda, JP | 8 |
| Riverside, US | 7 |
| Berlin, DE | 7 |
| Oswego, US | 7 |
| Bend, US | 7 |
| Kushiro City Museumlocation not on record | 7 |
| Institute of the biological problems of the North FEB RASlocation not on record | 7 |
| BClocation not on record | 6 |
| BSBIlocation not on record | 6 |
| ASUlocation not on record | 6 |
| ifplocation not on record | 6 |
| nbflocation not on record | 6 |
| Rocky Mountain Biological Laboratorylocation not on record | 6 |
| Glarus, CH | 6 |
| Logan, US | 6 |
| Servico de Microbiologia e Imunologialocation not on record | 6 |
| University of Wisconsinlocation not on record | 6 |
| Albuquerque, US | 6 |
| Paris, FR | 6 |
| Fulda, DE | 5 |
| Salamanca, ES | 5 |
| Chicago, US | 5 |
| Beijing, CN | 5 |
| Otaru, JP | 5 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 5 |
| Northeastern Forestry Universitylocation not on record | 5 |
| Anchorage, US | 5 |
| Chadron, US | 5 |
| Wellington, NZ | 5 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 5 |
| Frauenfeld, CH | 5 |
| Royal Botanic Garden Edinburghlocation not on record | 5 |
| BDBClocation not on record | 5 |
| Tromso University Museumlocation not on record | 4 |
| Boise, US | 4 |
| Tula State Universitylocation not on record | 4 |
| KIRMlocation not on record | 4 |
| Kew, GB | 4 |
| Barcelona, ES | 4 |
| Arcata, US | 4 |
| Dekalb, US | 4 |
| Hokkaido University Museumlocation not on record | 4 |
| San Angelo, US | 4 |
| International Salmonella Centre (W.H.O.)location not on record | 4 |
| Forssa, FI | 4 |
| DOI/FWS, Kenai National Wildlife Refugelocation not on record | 4 |
| CASlocation not on record | 3 |
| BIO-UNIPIlocation not on record | 3 |
| Chicago, US | 3 |
| Obihiro Centennial City Museumlocation not on record | 3 |
| Philadelphia, US | 3 |
| Dover, US | 3 |
| Mississippi State, US | 3 |
| Chiba, JP | 3 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 3 |
| Dresden, DE | 3 |
| Finnish Museum of Natural Historylocation not on record | 3 |
| Knoxville, US | 3 |
| Kostrzyca Forest Gene Banklocation not on record | 3 |
| Ypsilanti, US | 3 |
| Kochi, JP | 3 |
| Dhaka, BD | 3 |
| National Museum Waleslocation not on record | 3 |
| Xiamen, CN | 2 |
| University of Gdansk, Dept. of Plant Taxonomy & Nature Conservationlocation not on record | 2 |
| Royal Botanical Gardenslocation not on record | 2 |
| Royal Alberta Museumlocation not on record | 2 |
| Phoenix, US | 2 |
| College Park, US | 2 |
| Henderson, US | 2 |
| Museum of the Rockieslocation not on record | 2 |
| Bando, JP | 2 |
| Fredericton Stock Culture Collectionlocation not on record | 2 |
| San Sebastián, ES | 2 |
| BioFokuslocation not on record | 2 |
| University of Wisconsinlocation not on record | 2 |
| NMBU:MINAlocation not on record | 2 |
| Yellowstone National Park Herbariumlocation not on record | 1 |
| Williamsburg, US | 1 |
| cslocation not on record | 1 |
| UnBlocation not on record | 1 |
| Delaware State University, Claude E. Phillips Herbariumlocation not on record | 1 |
| Lausanne, CH | 1 |
| Truckee, US | 1 |
| Akita Prefectural Museumlocation not on record | 1 |
| UGentlocation not on record | 1 |
| Davenport, US | 1 |
| Canadian Department of Agriculturelocation not on record | 1 |
| San Jose, US | 1 |
| València, ES | 1 |
| Vitoria, ES | 1 |
| Umeå Universitylocation not on record | 1 |
| State University of New York, College at Oneontalocation not on record | 1 |
| Bruce Peninsula National Parklocation not on record | 1 |
| University of Lethbridgelocation not on record | 1 |
| NMWlocation not on record | 1 |
| Moscow University Herbarium (MW)location not on record | 1 |
| NoColllocation not on record | 1 |
| DULlocation not on record | 1 |
| Tilburg, NL | 1 |
| Science Museum of Minnesotalocation not on record | 1 |
| San Luis Obispo, US | 1 |
| Bourges, FR | 1 |
| KR | 1 |
| Staten Island, US | 1 |
| Nishihara, JP | 1 |
| Universidad de La Salle (La Salle)location not on record | 1 |
| Trois-Rivières, CA | 1 |
| Shrewsbury Schoollocation not on record | 1 |
| Göteborg, SE | 1 |
| Herb. BBGlocation not on record | 1 |
| Durango, US | 1 |
| DOI/NPS, Mount Rainier National Parklocation not on record | 1 |
| Omachi Alpine Museumlocation not on record | 1 |
| US | 1 |
| Kiritappu Wetland National Trustlocation not on record | 1 |
| No collectionlocation not on record | 1 |
| Chapel Hill, US | 1 |
| Columbia, US | 1 |
| Universität Erlangen-Nürnberglocation not on record | 1 |
| Pittsburg, US | 1 |
| ULBF-AGRlocation not on record | 1 |
| Kharazmi Universitylocation not on record | 1 |
| HJAEFlocation not on record | 1 |
| Podgorica, ME | 1 |
| Uniwersytet Warszawskilocation not on record | 1 |
| Museo Nacional de Costa Rica (MNCR)location not on record | 1 |
| Sagamihara, JP | 1 |
248 institutions · 11 404 of 12 044 vouchered records shown · 531 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA46 detections
Where the DNA of Carex limosa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found46
Studies independent surveys2
Countries8
Signal confidence: moderateweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 46 detections have coordinates
Open the map8 countries0
Floating mat
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median15.7 °C 10.7–17.0
Seasonal swing summer↔winter21.3 °C
Max temp (day)20.0 °C 14.0–21.0
Min temp (night)11.2 °C 4.90–12.8
Precipitation74.1 mm/mo 61.4–101
Air humidity59.8 % 58.2–63.7
Moisture balance-45.5 mm/mo -66.7–12.4
Vapour deficit717 Pa 529–775
Wind speed3.90 m/s 2.70–4.60
Cloud cover32.3 % 32.3–53.8
CHELSA 1981–2010, ~9 km grid, at location & month of 39 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.