Carettochelys insculpta

Ramsay, 1886 · species

image placeholder — illustration coming later

Animalia/Chordata/Testudines/Carettochelyidae/Carettochelys

At a glance

Occurrence records1 049

Data sources12

Biological traits10

DNA specimens14

eDNA detections4

Sources12 archives

Databases and archives Carettochelys insculpta's data was compiled from.

WikipediaWikimedia Foundation19 languages↗

Animal Diversity WebUniv. of Michigan MZspecies account↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 049 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics14 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

Tree of SexTree of Sex Consortiumgenome & karyotype↗

Paleobiology DatabasePBDB consortiumfossil record↗

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeADW · Wikipediaarticle

Traits & measurements3 literature sources10 traits

Occurrence & distributionGBIF1 049 records

Environmental DNA1 datasets · 0 countries4 detections

DNA & barcodingBOLD14 specimens

Genome at a glanceGoaT · TreeOfSex · NCBI≈2.2 Gbp

01Narrative

The pig-nosed turtle (Carettochelys insculpta), also known as the pitted-shelled turtle or Fly River turtle, is a species of turtle native to northern Australia and southern New Guinea. It is the only living member of the family Carettochelyidae, which are related to softshell turtles.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAmnioteDBAnAgeSeaLifeBase

Size & morphology2

Body mass16 275 g

Body mass (female)10 050 g

Life cycle & reproduction6

Egg mass36.95 g

Incubation69 days

Litter size22.5

Litters per year0.75 /year

Max. longevity461 months

Neonate mass31 g

Habitat & environment2

Habitat freshwateryes

Habitat zonedemersal

05DNA & barcoding14 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Carettochelys insculpta has left across the world's sequence archives.

At a glance

DNA specimens14

BINs1

Marker genes11

eDNA detections4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P650 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.21%

Haplotypes2

BIN1

Most divergent pair0.31%

Where individuals differ — all 2 variable positions, in barcode order

38Avariable

342Cvariable

TGTACCTAATATTCGGAGCCTGAGCAGCAATAGTAGGAACAGGACTAAGCCTAGCAATTCGTATAGACCTAACTCAACCAGGCACTCTCT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Eudynamys scolopaceussame order17.2%Locustella lanceolatasame order17.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5PCOIICOXIIICYTBND1ND2ND3ND4ND4LND5-0ND6

animal barcodemitochondrial

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_014048 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND1ND2COX1COX2ATP8ATP6COX3ND3ND4LND4ND5ND6CYTBs-rRNAl-rRNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

06Genome at a glanceGoaT · TreeOfSex · NCBI

The complete instruction manual Carettochelys insculpta carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈2 180 317 067 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Carettochelys insculpta2.18 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 68 n = 34

Chromosome records68–682n range68median68mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 684×GoaT · Animal Chromosome Counts Database · GoaT · Tree of Sex Database · TreeOfSex · vert

GoaT · Animal Chromosome Counts Database — ↗

GoaT · Tree of Sex Database — ↗

TreeOfSex · vert — Bickham J.W., Bull J.J., Legler J.M. (1983) Karyotypes and evolutionary relationships of trionychoid turtles. Cytologia 48: 177-183. ↗

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

07Deep time~145 Ma lineage

How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.

At a glance

DNA clock origin145 Ma TimeTree

When this lineage existed

How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard periods (Jurassic, Cretaceous…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. The dashed rules marked ✦ are the five great mass extinctions. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.

DNA clock originmass extinction

How it livedPBDB

Environmentfreshwater

Life habitaquatic

Dietherbivore, omnivore

Motilityactively mobile

Compositionhydroxyapatite

Reproductionoviparous

08Occurrence & distribution

Record type1 049 records

Wild obs. + sensor123

Museum / vouchered925

Other1

Range

Area of Occupancy AOO800 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy17% within 1 km

≤100 m 4≤1 km 2>10 km 29

35 georeferenced · 88 without coordinates

Open the mapobservation + sensor123

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy3% within 1 km

≤100 m 2≤1 km 4≤10 km 38>10 km 134

178 georeferenced · 747 without coordinates

Open the institutions mapphysical evidence925

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Sydney, AU	135
Museum and Art Gallery of the Northern Territorylocation not on record	25
Australian National Wildlife Collectionlocation not on record	23
Cambridge, US	17
Natural History Museum of Utahlocation not on record	14
CASlocation not on record	4
Natick, US	4
Museums Victorialocation not on record	4
North Carolina Museum of Natural Scienceslocation not on record	4
Washington, US	3
Wuzhou, CN	1
Berkeley, US	1
Honolulu, US	1
South Kensington, GB	1
DOI/NPS, Salem Maritime National Historic Sitelocation not on record	1

15 institutions · 238 of 925 vouchered records shown · 687 without an institution code

09Environmental DNA4 detections

Where the DNA of Carettochelys insculpta was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Carettochelys insculpta

At a glance

Sources12 archives

Size & morphology2

Life cycle & reproduction6

Habitat & environment2

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Sequencing statusassembly quality — how far to trust these numbers

At a glance

When this lineage existed

How it livedPBDB

Record type1 049 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions8 of 15 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type1 049 records