Carbomyces emergens

Gilkey · species

image placeholder — illustration coming later

Fungi/Ascomycota/Pezizomycetes/Pezizales/Carbomycetaceae/Carbomyces

At a glance

Occurrence records10

Data sources8

Biological traits0

DNA specimens1

eDNA detections1

Sources8 archives

Databases and archives Carbomyces emergens's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility10 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF10 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Carbomyces emergens is a desert truffle in the genus Carbomyces, a small genus common to the Chihuahuan desert in the southwestern United States and Mexico. C. emergens is regarded as the most common and widely distributed species in Carbomyces, also serving as the genus' type species. C. emergens belongs to the Carbomycetaceae family, in the order Pezizales, class Pezizomycetes, division Ascomycota.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Carbomyces emergens has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences3

eDNA detections1

Countries2

The DNA barcodea real sequence read deposited for this species

ITSJQ023163.1 ↗538 bpMexico

ACGT

ACCCCTTTGTTAACCATACCATGTTGCTTCCACTGGACAGTGCGAGCTTATTGTCTTCAAAACACAATAAGTGAGCCCTCTGGCTCTAGT …

Carbomyces emergens voucher AH 39344 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS3

fungal barcode

08Occurrence & distribution

Record type10 records

Wild obs. + sensor1

Museum / vouchered9

Range

Area of Occupancy AOO32 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapobservation + sensor1

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy14% within 1 km

≤100 m 1≤10 km 2>10 km 4

7 georeferenced · 2 without coordinates

Open the institutions mapphysical evidence9

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bernard Price Institute for Palaeontological Researchlocation not on record	6
Bronx, US	1
Centro de Estudios Superiores del Estado de Sonoralocation not on record	1
California State University, East Baylocation not on record	1

4 institutions · 9 of 9 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Carbomyces emergens was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

Shrubland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.2 °C 12.2–12.2

Seasonal swing summer↔winter17.9 °C

Max temp (day)17.6 °C

Min temp (night)7.20 °C

Precipitation37.6 mm/mo

Air humidity55.2 %

Moisture balance-62.7 mm/mo

Vapour deficit642 Pa

Wind speed2.10 m/s

Cloud cover43.1 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)