Caputia tomentosa

(Haw.) B.Nord. & Pelser · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Caputia

At a glance

Occurrence records18

Data sources11

Biological traits14

DNA specimens2

eDNA detections2

Sources11 archives

Databases and archives Caputia tomentosa's data was compiled from.

WikipediaWikimedia Foundation8 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility18 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources14 traits

Chemical compositionLOTUS · NPASS16 compounds

Occurrence & distributionGBIF18 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB2n = 20

01Narrative

Caputia tomentosa, known as the woolly senecio and the matted caputia, is a perennial, succulent dwarf shrub of the Caputia genus that grows in the Cape Provinces of South Africa, usually between the altitudes of 900 and 1200 meters. It has been introduced to Myanmar. It has gained the Royal Horticultural Society's Award of Garden Merit as an ornamental.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology2

Plant height max0.5 m

Plant height min0.3 m

Life cycle & reproduction2

Life formsucculent subshrub or shrub

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max1 220 m

Elevation min905 m

Epiphyteterrestrial

Growth formshrub

Woodinesswoody

Other traits1

Plant support typefree-standing

03Chemical composition16 compounds

Compounds documented for Caputia tomentosa across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Isocoumarins4

Naphthalenes and derivatives2

Humulane sesquiterpenoids2

Naphthalenones $ Naphthoquinones1

Bicyclogermacrane sesquiterpenoids $ Cyclogermacrane sesquiterpenoids1

Documented compounds16 total

Tissue Source Quantified only

Compound	Amount	Source
(3R)-5,8-dihydroxy-3-methyl-3,4-dihydroisochromen-1-one	present	NPASS
1,8-Dihydroxynaphthalene	present	NPASS
2,3-Epoxy-1,2,3,4-tetrahydronaphthalene-c-1,c-4,8-triol	present	NPASS
2,5-Dimethyl-7-Hydroxychromone	present	NPASS
24-Methylenecycloartan-3-ol	present	NPASS
3,4-Dehydro-6-hydroxymellein	present	NPASS
6,6,9-Trimethylcycloundeca-1,4,8-triene	present	LOTUS
6,7,8-Trihydroxy-3-methyl-1H-isochromen-1-one	present	NPASS
cis-4-Hydroxymellein	present	NPASS
Ergosta-4,6,8(14),22-Tetraen-3-One	present	NPASS

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Caputia tomentosa has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes2

GenBank sequences1

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKJ561193.1 ↗617 bp

ACGT

GAACGACCCGTGAACATGTAACAAATATAGGTGTCCTTTTTATCCGGCTCTTGCCTGATTCTTTGGATGCCTTGTCAATGTGCGTCTTGG …

Caputia tomentosa internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1★ITS2

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Caputia tomentosa carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 20 n = 10

Ploidydiploid inferred

Chromosome records18–202n range19median20mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 181×CCDB · book-indian_vol1

CCDB · book-indian_vol1 — Gupta, P.K. 1969b; Shetty, B.V. 1967

2n 201×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Arano, H. 1977. Cytological studies in subfamily Carduoideae of Compositae XXIX. Chromosome analysis in some species of foreign succulent Senecio (1.) J. Saitama Univ. Fac. Educ. 26: 5–16.

n 91×CCDB · book-ipcn67-71

CCDB · book-ipcn67-71 — GUPTA, P.K. 1969. Cytological investigations in some Indian Composi Cytologia 34: 429-438.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type18 records

Wild obs. + sensor16

Museum / vouchered2

Range

Area of Occupancy AOO48 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy80% within 1 km

≤100 m 10≤1 km 2≤10 km 1>10 km 2

15 georeferenced · 1 without coordinates

Open the mapobservation + sensor16

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the institutions mapphysical evidence2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 1 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Cape Town, ZA	1

1 institutions · 1 of 2 vouchered records shown

09Environmental DNA2 detections

Where the DNA of Caputia tomentosa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.8 °C 18.8–18.8

Seasonal swing summer↔winter15.6 °C

Max temp (day)26.6 °C

Min temp (night)11.7 °C

Precipitation34.5 mm/mo

Air humidity48.3 %

Moisture balance-98.6 mm/mo

Vapour deficit1,186 Pa

Wind speed2.90 m/s

Cloud cover16.3 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)