Capsicum mirabile

Mart. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Solanales/Solanaceae/Capsicum

At a glance

Occurrence records93

Data sources7

Biological traits11

DNA specimens0

eDNA detections0

Sources7 archives

Databases and archives Capsicum mirabile's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility93 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources11 traits

Occurrence & distributionGBIF93 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 26

01Narrative

Capsicum mirabile là loài thực vật có hoa trong họ Cà. Loài này được Sendtn. mô tả khoa học đầu tiên năm 1846.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formshrub

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Growth formshrub

Habitat GIFTFloresta Estacional Semidecidual, Floresta Ombrófila (= Floresta Pluvial)

Woodinesswoody

Other traits1

Plant support typefree-standing

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Capsicum mirabile has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

The DNA barcodea real sequence read deposited for this species

matKKP747422.1 ↗1 673 bp

ACGT

CTTTGGTTCAAATCGAATTTCAAATGGAAGAAATCCAAAGATATTTACAGCTAGATAGCTCGCAACAACACAACTTCCTATATCCACTTA …

Capsicum mirabile voucher Barboza & Carrizo Garcia 3632 maturase K (matK) gene, complete cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Capsicum mirabile carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 26 n = 13

Ploidydiploid inferred

Chromosome records26–262n range26median26mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 262×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Pozzobon, M. T. 2006. Chromosome numbers in wild and semidomesticated Brazilian Capsicum L. (Solanaceae) species: Do x = 12 and x = 13 represent two evolutionary lines?. Bot. J. Linn. Soc. 151: 259–269.

CCDB · ipcn-api-dl — Moscone, E. A., J. Loidl, F. Ehrendorfer & A. T. Hunziker. 1995. Analysis of active nucleolus organizing regions in Capsicum (Solanaceae) by silver staining. Amer. J. Bot. 82(2): 276–287.

n 123×CCDB · solan

CCDB · solan

n 131×CCDB · solan

CCDB · solan

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type93 records

Wild obs. + sensor1

Museum / vouchered81

Other11

Origin

Native49

Range

Area of Occupancy AOO196 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced

Open the mapobservation + sensor1

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

>10 km 2

2 georeferenced · 79 without coordinates

Open the institutions mapphysical evidence81

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 26 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
CEPLAClocation not on record	12
UFMGlocation not on record	11
JBRJlocation not on record	8
UFOPlocation not on record	5
Bronx, US	4
Ivano-Frankivsk, UA	4
San Jose State University, Museum of Birds and Mammalslocation not on record	4
Brasília, BR	3
Cenargenlocation not on record	3
Córdoba, AR	3
Istituto Agrario Castelnuovolocation not on record	2
Santarém, BR	2
UNICAMPlocation not on record	2
Blumenau, BR	2
IPA/SPlocation not on record	2
UEMlocation not on record	2
Chicago, US	2
Laboratorio de Ictiologialocation not on record	1
Saint Louis, US	1
INMAlocation not on record	1
UFABClocation not on record	1
Cascavel, BR	1
Museu Paraense Emílio Goeldilocation not on record	1
Maringá, BR	1
FPMZBlocation not on record	1
UFSClocation not on record	1

26 institutions · 80 of 81 vouchered records shown · 1 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)