Capsicum frutescens
speciesAt a glance
Occurrence records3 017
Data sources11
Biological traits53
DNA specimens66
eDNA detections63
Sources11 archives
Databases and archives Capsicum frutescens's data was compiled from.
GBIFGlobal Biodiversity Information Facility3 017 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI63 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics66 specimens↗
NCBIUS National Library of Medicinesequences↗
foodatlascompounds
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
giftgenome & karyotype
GoaTGenomes on a Tree · Sangergenome & karyotype↗
Paleobiology DatabasePBDB consortiumfossil record↗On this page6 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
Traits & measurements4 literature sources53 traits
Chemical compositionFoodAtlas · NPASS67 compounds
Occurrence & distributionGBIF3 017 records
Environmental DNA1 datasets · 7 countries63 detections
DNA & barcodingBOLD · NCBI66 specimens
Genome at a glanceGIFT · GoaT3.7 Gbp
02Traits & measurements
SourcesWCVPGIFTAusTraitsTRY
Size & morphology25
Fruit length15 mm
Fruit length max20 mm
Fruit length min10 mm
Fruit width5 mm
Inflorescence length max2 500 cm
Inflorescence length min1 cm
Leaf length100 mm
Leaf length max70 mm
Leaf length min10 mm
Leaf width50 mm
Leaf width max100 mm
Leaf width min15 mm
Petiole length2 cm
Plant height1.1 m
⚠ sources differ — GIFT: 1.1 m · AusTraits: 2 m · TRY: 0.8 m
Plant height max2 m
Plant height min0.25 m
Seed length4 mm
Seed length max4 mm
Seed length min3 mm
Seed mass5 mg
⚠ sources differ — TRY: 5 mg · GIFT: 3.09 mg
Seed mass max5.8 mg
Seed mass min1.19 mg
Seed volume11 mm³
Seed volume max11 mm³
Seed volume min11 mm³
Life cycle & reproduction11
Deciduousnessevergreen
Dehiscenceindehiscent
Dispersal typeanimal
Flower colourwhite
Flowering timeyynnnnnnnnny
Life formsubshrub or shrub
Life spanannual short_lived_perennial
⚠ sources differ — AusTraits: annual short_lived_perennial · GIFT: perennial
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formchamaephyte
Self fertilizationpresent
Diet & foraging1
Parasiteindependent
Habitat & environment14
Aquaticterrestrial
Climateseasonally dry tropical
Climberself-supporting
Elevation max1 700 m
Elevation min0 m
Epiphyteterrestrial
Fruit fleshinessfleshy
Fruit typeberry
Growth formshrub
⚠ sources differ — GIFT: shrub · AusTraits: herb shrub · TRY: Shrub
Habitat GIFTÁrea Antrópica
Leaf compoundnesssimple
Leaf shapelanceolate ovate
Succulenceno
Woodinessnon-woody
⚠ sources differ — TRY: non-woody · AusTraits: herbaceous woody · GIFT: non-woody
Physiology & chemistry2
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
03Chemical composition67 compounds
Compounds documented for Capsicum frutescens across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
🍽 Used in cooking
Compound class profile5 classes
Steroidal alkaloids4
Eremophilane sesquiterpenoids2
Capsaicins and Capsaicinoids $ Phenylalanine-derived alkaloids2
Spirovetivane sesquiterpenoids1
Capsaicins and Capsaicinoids1
Documented compounds67 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| folates | 0.072 mg/100g | FoodAtlas | |
| folic acids | 0.072 mg/100g | FoodAtlas | |
| folate(2-) | 0.058 mg/100g | FoodAtlas | |
| folic acid | 0.058 mg/100g | FoodAtlas |
05DNA & barcoding66 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Capsicum frutescens has left across the world's sequence archives.
At a glance
DNA specimens66
Marker genes5
GenBank sequences10
eDNA detections63
Countries7
The DNA barcodea real sequence read deposited for this species
CTTTTCGTTTCTTTCGAACGGGGGGGACGGGTCATTGTTAAAATTTTCAAAAGGGGCACGACCCAGGAACCTCTTTATCAACTTACCAGC …
Capsicum frutescens haplotype H4 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK4★rbcL2★ITS4★ITS2trnH-psbA
plant barcodefungal barcodemarker
06Genome at a glanceGIFT · GoaT
The complete instruction manual Capsicum frutescens carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size3 743 295 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
HUMAN3.2 Gb
THIS GENOME Capsicum frutescens3.74 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 24 n = 12
Ploidy2× diploid · measured
Chromosome records24–242n range24median24mode4records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 244×GoaT · Kew Plant DNA C-values Database · GIFT · GIFT (floras)
GoaT · Kew Plant DNA C-values Database — ↗
GIFT · GIFT (floras)
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid2×GoaT · Kew Plant DNA C-values Database · GIFT · GIFT (floras)
GoaT · Kew Plant DNA C-values Database
GIFT · GIFT (floras)
08Occurrence & distribution
Record type3 017 records
Wild obs. + sensor341
Museum / vouchered1 888
Cultivated / captive316
Other472
Origin
Native3
Introduced121
Range
Area of Occupancy AOO6 432 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy69% within 1 km
≤100 m 135≤1 km 26≤10 km 36>10 km 38
235 georeferenced · 106 without coordinates
Open the mapobservation + sensor341
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy67% within 1 km
≤100 m 263≤1 km 41≤10 km 124>10 km 25
453 georeferenced · 1 435 without coordinates
Open the institutions mapphysical evidence1 888
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
≤10 km 16>10 km 12
28 georeferenced · 288 without coordinates
Open the mapnot free-living316
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions109 of 210 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Instituto Amazónico de Investigaciones Científicas - SINCHIlocation not on record | 150 |
| Saint Louis, US | 126 |
| Chapingo, MX | 102 |
| MeiseBGlocation not on record | 97 |
| Brisbane, AU | 73 |
| Bronx, US | 73 |
| Durango, MX | 54 |
| Kew, GB | 46 |
| South Kensington, GB | 43 |
| Yaoundé, CM | 42 |
| Bloomington, US | 39 |
| Guangzhou, CN | 26 |
| University of Stellenboschlocation not on record | 22 |
| Taipei, TW | 20 |
| Miami, US | 20 |
| Mexico City, MX | 16 |
| Chicago, US | 16 |
| Museo Entomologico de Leonlocation not on record | 16 |
| Cenargenlocation not on record | 14 |
| Mérida, MX | 14 |
| Canberra, AU | 14 |
| Brasília, BR | 13 |
| Paris, FR | 13 |
| Laboratorio de Ictiologialocation not on record | 12 |
| LSF/FSA/UAClocation not on record | 12 |
| Nanjing, CN | 11 |
| Baroda, IN | 10 |
| Istituto Agrario Castelnuovolocation not on record | 10 |
| Université du Lomélocation not on record | 10 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 9 |
| Tapachula, MX | 9 |
| National Biodiversity Institute, Costa Ricalocation not on record | 9 |
| Tsukuba, JP | 8 |
| Xiamen, CN | 8 |
| Universidad Nacional de Colombia (UNAL)location not on record | 8 |
| Beijing, CN | 8 |
| Jena Microbial Resource Collectionlocation not on record | 8 |
| UFBAlocation not on record | 7 |
| Chaguaramas, TT | 7 |
| Université de Strasbourglocation not on record | 7 |
| Universidad de Nariño (UdeNar)location not on record | 7 |
| Honolulu, US | 7 |
| Departamento de Sistematica e Ecologialocation not on record | 7 |
| Instituto do Meio Ambientelocation not on record | 7 |
| QCNElocation not on record | 7 |
| Nishihara, JP | 7 |
| Chengdu, CN | 6 |
| UFPIlocation not on record | 6 |
| Pretoria, ZA | 6 |
| Smithfield, AU | 6 |
| Tampa, US | 6 |
| MAlocation not on record | 5 |
| UEPAlocation not on record | 5 |
| Centro Cultural Santo Domingolocation not on record | 5 |
| Universidad de Caldas (UCaldas)location not on record | 5 |
| Guangzhou, CN | 5 |
| Philadelphia, US | 5 |
| Aarhus, DK | 5 |
| Universidade Federal do Rio Grande do Nortelocation not on record | 5 |
| Riverside, US | 5 |
| Universidad Juárez Autónoma de Tabascolocation not on record | 5 |
| WNNUlocation not on record | 4 |
| CEPLAClocation not on record | 4 |
| Universidade Federal de Goiáslocation not on record | 4 |
| Herbier National du Gabonlocation not on record | 4 |
| San José, CR | 4 |
| TAFORI-LSRClocation not on record | 4 |
| Mérida, MX | 4 |
| Wuhan, CN | 4 |
| Cambridge, US | 4 |
| HNBlocation not on record | 4 |
| Guiyang, CN | 3 |
| Bangkok, TH | 3 |
| UEMlocation not on record | 3 |
| HUN003location not on record | 3 |
| Universidad de La Salle (La Salle)location not on record | 3 |
| Chongqing Museumlocation not on record | 3 |
| Auckland, NZ | 3 |
| Christchurch, NZ | 3 |
| Juriquilla, MX | 3 |
| Empresa Pernambucana de Pesquisa Agropecuária, IPAlocation not on record | 3 |
| Davis, US | 3 |
| Durham, US | 3 |
| BISHlocation not on record | 3 |
| Departamento de Geologia, Universidad de Chilelocation not on record | 3 |
| University of New Hampshirelocation not on record | 3 |
| Centre Suisse de Recherches Scientifiques en Côte d’Ivoirelocation not on record | 3 |
| Salvador, BR | 3 |
| ASUlocation not on record | 3 |
| James Cook Townsvillelocation not on record | 3 |
| JBRJlocation not on record | 3 |
| Santa Cruz de la Sierra, BO | 3 |
| CNF-UFHBlocation not on record | 2 |
| Xinxiang, CN | 2 |
| Pullman, US | 2 |
| Wuhan, CN | 2 |
| Guasave, MX | 2 |
| Centre National de la Recherche Appliquée au Developement Rurallocation not on record | 2 |
| UFPElocation not on record | 2 |
| Museo Athanasius Kircher di Romalocation not on record | 2 |
| Ilhéus, BR | 2 |
| Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record | 2 |
| Berlin, DE | 2 |
| Austin, US | 2 |
| UFERSAlocation not on record | 2 |
| UNEMATlocation not on record | 2 |
| Santarém, BR | 2 |
| Ciudad de México, MX | 2 |
| Masindi, UG | 2 |
| Instituto de Investigação Científica Tropicallocation not on record | 2 |
| Frankfurt am Main | 2 |
| Uberlândia, BR | 2 |
| UFMGlocation not on record | 2 |
| Austin, US | 2 |
| Montecillo, Texcoco, MX | 2 |
| Universidade Federal de Sergipe (UFS)location not on record | 2 |
| UnBlocation not on record | 2 |
| Post Graduate College Bannulocation not on record | 2 |
| UNESP-FCAlocation not on record | 2 |
| Córdoba, AR | 2 |
| Guilin, CN | 2 |
| Criciúma, BR | 1 |
| URCAlocation not on record | 1 |
| Feira de Santana, BR | 1 |
| Leiden University Medical Centerlocation not on record | 1 |
| Quito, EC | 1 |
| NLD037location not on record | 1 |
| Guatemala, GT | 1 |
| UFRRJlocation not on record | 1 |
| Clemson, US | 1 |
| LBVlocation not on record | 1 |
| ESP026location not on record | 1 |
| Millersville, US | 1 |
| UFMSlocation not on record | 1 |
| Station d'Ecologie de Lamtolocation not on record | 1 |
| Plocation not on record | 1 |
| Universidad Industrial de Santander (UIS)location not on record | 1 |
| Denver, US | 1 |
| Centre National de la Recherche Scientifique et Technologique / Institut de l'environnement et de recherches agricoleslocation not on record | 1 |
| Museu Nacional, Universidade Federal do Rio de Janeirolocation not on record | 1 |
| Universidade Federal do Ceara, Departamento de Biologialocation not on record | 1 |
| “Manash Kozybayev North Kazakhstan University" NPLClocation not on record | 1 |
| UNESClocation not on record | 1 |
| Mexico City, MX | 1 |
| Herbario Selva Central Oxapampa - estación biológica del Jardín Botánico de Missourilocation not on record | 1 |
| ROM007location not on record | 1 |
| Corrientes, AR | 1 |
| UFAClocation not on record | 1 |
| Universidad de Guayaquillocation not on record | 1 |
| Dirección Nacional Forestal, Ministerio de Agricultura y Ganaderíalocation not on record | 1 |
| Arusha, TZ | 1 |
| Kensington, AU | 1 |
| La Paz, BO | 1 |
| MEXUlocation not on record | 1 |
| Mount Annan, AU | 1 |
| Tlalnepantla, MX | 1 |
| Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record | 1 |
| Addis Ababa, ET | 1 |
| Iquitos, PE | 1 |
| Glocation not on record | 1 |
| Cochabamba, BO | 1 |
| UNIVASFlocation not on record | 1 |
| Columbia, US | 1 |
| Nanjing, CN | 1 |
| CJBGlocation not on record | 1 |
| Chapel Hill, US | 1 |
| Tamil Nadu Agricultural Universitylocation not on record | 1 |
| BAYLUlocation not on record | 1 |
| Adelaide, AU | 1 |
| Durban, ZA | 1 |
| GAlocation not on record | 1 |
| Institut fur Allgemeine Mikrobiologielocation not on record | 1 |
| University of Zhejianglocation not on record | 1 |
| RBGlocation not on record | 1 |
| Cincinnati, US | 1 |
| Burlington, US | 1 |
| UEMAlocation not on record | 1 |
| UNITINSlocation not on record | 1 |
| Zürich, CH | 1 |
| St. Paul, US | 1 |
| New Haven, US | 1 |
| DSMlocation not on record | 1 |
| FAUSAClocation not on record | 1 |
| Instituto de Investigaciones Biológicas, Universidad Veracruzana, Región Xalapalocation not on record | 1 |
| Jackson, US | 1 |
| Madison, US | 1 |
| Riobamba, EC | 1 |
| Phoenix, US | 1 |
| La Paz, MX | 1 |
| St. Augustine, TT | 1 |
| HUT Culture Collectionlocation not on record | 1 |
| Uppsala, SE | 1 |
| Toronto, CA | 1 |
| BRLUlocation not on record | 1 |
| Mexico City, MX | 1 |
| Staten Island, US | 1 |
| Palmerston, AU | 1 |
| Tuxtla Gutiérrez, MX | 1 |
| Gump Stationlocation not on record | 1 |
| Ciudad de México, MX | 1 |
| Instituto Tecnológico del Valle de Oaxacalocation not on record | 1 |
| Mexico City, MX | 1 |
| San Francisco, US | 1 |
| CMULlocation not on record | 1 |
| Cusco, PE | 1 |
| LSFlocation not on record | 1 |
| UFRPElocation not on record | 1 |
| UTFPR-CPlocation not on record | 1 |
| Seropédica, BR | 1 |
| Cruz das Almas, BR | 1 |
210 institutions · 1 574 of 1 888 vouchered records shown · 264 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA63 detections
Where the DNA of Capsicum frutescens was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found63
Studies independent surveys1
Countries7
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 63 detections have coordinates
Open the map7 countries0
Cultivated Habitat
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median25.6 °C 24.1–25.7
Seasonal swing summer↔winter3.60 °C
Max temp (day)29.6 °C 28.0–29.8
Min temp (night)22.3 °C 19.7–22.3
Precipitation222 mm/mo 137–230
Air humidity64.7 % 64.7–65.4
Moisture balance67.7 mm/mo 14.5–76.1
Vapour deficit1,175 Pa 1,082–1,175
Wind speed2.60 m/s 1.60–2.60
Cloud cover68.7 % 28.9–68.7
CHELSA 1981–2010, ~9 km grid, at location & month of 54 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.