Capsicum annuum
speciesAt a glance
Occurrence records13 540
Data sources19
Biological traits57
DNA specimens142
eDNA detections142
Sources19 archives
Databases and archives Capsicum annuum's data was compiled from.
WikipediaWikimedia Foundation18 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility13 540 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI142 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics142 specimens↗
NCBIUS National Library of Medicinesequences↗
dukesphytochemcompounds
FooDBThe Metabolomics Innovation Centrecompounds↗
foodatlascompounds
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗
WikidataWikimedia Foundationstructured facts↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources57 traits
Chemical compositionDukesPhytochem · FooDB · FoodAtlas · LOTUS · NPASS7 162 compounds
Occurrence & distributionGBIF13 540 records
Environmental DNA3 datasets · 12 countries142 detections
DNA & barcodingBOLD · NCBI142 specimens
Genome at a glanceCCDB · GoaT · NCBI2.7 Gbp
01Narrative
Capsicum annuum var. glabriusculum is a variety of Capsicum annuum that is native to southern North America and northern South America. Common names include chiltepín, Indian pepper, chiltepe, and chile tepín, as well as turkey, bird’s eye, or simply bird peppers, due to their consumption and spread by wild birds, "unlike humans birds are impervious to the heat of peppers". Tepín is derived from a Nahuatl word meaning "flea". This variety is the most likely progenitor of the domesticated C. annuum var. annuum. Another similar-sized pepper, 'Pequin' (also called 'piquin') is often confused with tepin, although the tepin fruit is round to oval where as the pequin's fruit is oval with a point, and the leaves, stems and plant structures are very different on each plant.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesTRYLEDAGIFTAusTraitsWCVP
Size & morphology24
Fruit length25 mm
⚠ sources differ — AusTraits: 25 mm · GIFT: 100 mm
Fruit width7.5 mm
⚠ sources differ — AusTraits: 7.5 mm · GIFT: 15 mm
Leaf length120 mm
⚠ sources differ — AusTraits: 120 mm · GIFT: 85 mm
Leaf length max130 mm
Leaf length min10 mm
Leaf width50 mm
⚠ sources differ — AusTraits: 50 mm · GIFT: 27.5 mm
Leaf width max120 mm
Leaf width min15 mm
Petiole length2.5 cm
Plant height0.7 m
⚠ sources differ — GIFT: 0.7 m · AusTraits: 2 m · TRY: 0.65 m
Plant height max2 m
Plant height min0.2 m
Seed length3 mm
Seed length max3 mm
Seed length min3 mm
Seed mass4.88 mg
⚠ sources differ — TRY: 4.88 mg · GIFT: 4.33 mg
Seed mass max7.87 mg
Seed mass min2.85 mg
Seed volume2.5 mm³
Seed volume max2.5 mm³
Seed volume min2.5 mm³
Seed width3 mm
Seed width max3 mm
Seed width min3 mm
Life cycle & reproduction14
Deciduousnessevergreen
⚠ sources differ — TRY: evergreen · GIFT: deciduous
Dehiscenceindehiscent
Flowering endSep
Flowering startJun
Flowering timennnyyyyyyyyn
Life formannual, subshrub or shrub
Life spanannual
⚠ sources differ — TRY: summer annuals · AusTraits: perennial · LEDA: summer annuals · GIFT: perennial
Lifespan years1 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formtherophyte
Reproduction asexualabsent
Resprouting capacityfire_killed
Self fertilizationpresent
Diet & foraging1
Parasiteindependent
Habitat & environment14
Aquaticterrestrial
Climateseasonally dry tropical
Climberself-supporting
Elevation max2 000 m
Elevation min0 m
Epiphyteterrestrial
Fruit fleshinessfleshy
Fruit typeberry
Growth formherb
⚠ sources differ — GIFT: herb · AusTraits: shrub · TRY: Shrub
Habitat GIFT(?)
Leaf compoundnesssimple
Leaf shapeovate
Mycorrhiza type0.000000000707
Woodinessvariable
⚠ sources differ — TRY: non-woody/woody · AusTraits: woody · LEDA: non-woody · GIFT: non-woody
Physiology & chemistry4
Leaf n39.9 mg/g
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
Specific leaf area (SLA)14.72 mm²/mg
03Chemical composition7 162 compounds
Compounds documented for Capsicum annuum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
🍽 Used in cookingDishesVegetables🌿 Spice
Compound class profile5 classes
Aminoacids720
Pyridine alkaloids170
pteridine alkaloids129
Carotenoids (C40, β-β)115
Prenol lipids100
Documented compounds7 162 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| CARBOHYDRATES | 813,000 ppm | DukesPhytochem | |
| WATER | 742,000 ppm | DukesPhytochem | |
| CAPSAICIN | 634,000 ppm | DukesPhytochem | |
| FIBER(DIETARY) | 482,000 ppm | DukesPhytochem | |
| FIBER | 351,000 ppm | DukesPhytochem | |
| DIHYDROCAPSAICIN | 318,000 ppm | DukesPhytochem | |
| FIBER(CRUDE) | 258,000 ppm | DukesPhytochem | |
| PROTEIN | 184,000 ppm | DukesPhytochem | |
| Glutamic acid | 180,000 mg/100g | FooDB | |
| L-Aspartic acid | 170,000 mg/100g | FooDB |
05DNA & barcoding142 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Capsicum annuum has left across the world's sequence archives.
At a glance
DNA specimens142
Marker genes7
GenBank sequences10
eDNA detections142
Countries12
The DNA barcodea real sequence read deposited for this species
GTTTAACAACTGGGGAGCCCGCTTGGGCGGGGTGCTACCGCCCTCCGCAGGAACGGCCCCCCCTCGCCCCCGGGCATGCAACCACTACGC …
Capsicum annuum haplotype H1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★COI-5P★matK3★rbcL5★rbcLa★ITS2★ITS2trnH-psbA
animal barcodeplant barcodefungal barcodemarker
Organelle genome
Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.
▸ Tap any coloured segment — or a gene chip — to see what it is
Mitochondrion
NC_024624 ↗ · 193 protein · 25 tRNA · 3 rRNA
orf293nad7orf109aorf125aorf109borf267orf277rps13nad1nad4Lorf25orf185orf138anad5rps4orf152aorf675orf337orf543orf108aorf102aorf112aorf101aorf102borf125bccmC+154
Pick a coloured segment on the ring — or a gene chip — to read what that gene does.
protein-codingrRNAtRNA
06Genome at a glanceCCDB · GoaT · NCBI
The complete instruction manual Capsicum annuum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size2 738 400 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Capsicum annuum2.74 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 24 n = 12
Ploidy2× diploid · measured
Chromosome records12–362n range24median24mode90records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 2480×GoaT · Kew Plant DNA C-values Database · CCDB · ipcn-api-dl · CCDB · book-ipcn66 +8
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · ipcn-api-dl — Rao, G. R. & O. A. Kumar. 1983a. Cytogenetics of spontaneous desynaptic mutant in chillies (Capsicum annuum L.). Cytologia 48: 195–199.
CCDB · ipcn-api-dl — Devadas, N., M. V. Rajam & K. Subhash. 1986. Comparative mutagenicity of four organophosphorous insecticides in meiotic system of red pepper. Cytologia 51: 645–653.
CCDB · ipcn-api-dl — Tanksley, S. D. 1984. Linkage relationships and chromosomal locations of enzyme-coding genes in pepper, Capsicum annuum. Chromosoma 89: 352–360.
CCDB · ipcn-api-dl — Limaye, V. A. & V. P. Patil. 1989. Karyomorphological studies in the genus Capsicum Linn. Cytologia 54: 455–463.
CCDB · ipcn-api-dl — Moscone, E. A., M. Lambrou, A. T. Hunziker & F. Ehrendorfer. 1993. Giemsa C-banded karyotypes in Capsicum (Solanaceae). Pl. Syst. Evol. 186: 213–229.
CCDB · ipcn-api-dl — Murín, A. 1993. Karyologické atúdium okrasn@3ych rastlín flóry Slovenska. Biologia (Bratislava) 48: 441–445.
CCDB · ipcn-api-dl — Singh, C. P., P. Singh & S. K. Sharma. 1991. Irradiation studies in Capsicum annuum (L.) (Solanaceae). Proc. Indian Sci. Congr. Assoc. 78(3,VIII): 145.
CCDB · ipcn-api-dl — Phulari, S. S. & G. B. Dixit. 1996. Cytological studies in Capsicum: I---Karyomorphological studies in parents and hybrids of Capsicum annuum and C. frutescens. Advances Pl. Sci. 9(2): 111–119.
CCDB · ipcn-api-dl — Badr, A., S. F. Khalifa, A. I. Aboel-Atta & M. M. Abou-El-Enain. 1997. Chromosomal criteria and taxonomic relationships in the Solanaceae. Cytologia 62: 103–113.
CCDB · ipcn-api-dl — Devi, N. 1993. Cytomorphological studies in 5 varieties of Capsicum annuum Linn. Proc. Indian Sci. Congr. Assoc. 80(3:VIII): 138.
CCDB · ipcn-api-dl — Zhang, C. s. 1998. Study on chromosmes of 5 species of plants. J. Yunnan Educ. Coll., Nat. Sci. Ed. 5: 44–46, 55.
CCDB · ipcn-api-dl — Zhang, C. s. 1998. A preliminary study on making plant chromosomal specimens using peppermint oil compound as pretreatment agent. J. Wuhan Bot. Res. 16(3): 280–282.
CCDB · ipcn-api-dl — Bir, S. S., S. Kumari, S. P. Shoree & M. S. Sagoo. 1978a. Cytological studies in certain Bicarpeilatse from north and central India. J. Cytol. Genet. 13: 99–106.
CCDB · ipcn-api-dl — Bir, S. S. & Neelam. 1980. In Chromosome number reports LXIX. Taxon 29: 711.
CCDB · ipcn-api-dl — Cawood, A.H. & J. K. Jones. 1980. Chromosome behaviour during meiotic prophase in the Solanaceae. Chromosoma 80: 57–68.
CCDB · ipcn-api-dl — INDIRA, C. & S. Abraham. 1978. Cytomixis during microsporogenesis in a tetraploid Capsicum annuum Linn. New Bot. 5: 59–62.
CCDB · ipcn-api-dl — Chen, R. y., W. q. Song, X. l. Li, M. x. Li, G. l. Liang, Z. p. An, C. b. Chen, Z. x. Qi & Y. z. Sun. 2003. Chromosome Atlas of Major Economic Plants Genome in China, Vol. 2, Chromosome Atlas of Crops and their Wild Kindred Plants in China Relatives. Science Press, Beijing.
CCDB · ipcn-api-dl — Alexeeva, O. G. 1999. Pecularities of meiosis in Capsicum annuum L. Citologija 41(12): 1054.
CCDB · ipcn-api-dl — Sengupta, K., A. Pal & A. K. Datta. 1999. Environmental stress induced desynapsis in Capsicum annuum L. and in Solanum americanum Mill. J. Natl. Bot. Soc. 53(1&2): 39–43.
CCDB · ipcn-api-dl — Li, R. q. 1989. Studies on Karyotypes of Vegetables in China
CCDB · ipcn-api-dl — Hu, J., R. q. Li & Z. s. Zeng. 1989. A cytotaxonomical study on Capsicum in China. Pp. 273--275 in D. Hong (editor), Plant Chromosome Research 1987.
CCDB · ipcn-api-dl — Li, G. t. & T. Liang. 1993. Karyotype studies on 4 taxa of Capsicum. Guihaia 13: 155–158.
CCDB · ipcn-api-dl — Moscone, E. A., J. Loidl, F. Ehrendorfer & A. T. Hunziker. 1995. Analysis of active nucleolus organizing regions in Capsicum (Solanaceae) by silver staining. Amer. J. Bot. 82(2): 276–287.
CCDB · ipcn-api-dl — Moscone, E. A., M. Lambrou & F. Ehrendorfer. 1996. Fluorescent chromosome banding in the cultivated species of Capsicum (Solanaceae). Pl. Syst. Evol. 202: 37–63.
CCDB · ipcn-api-dl — Moscone, E. A. 1993. Estudios cromosómicos en Capsicum (Solanaceae) II. Analisis cariotípico de C. parvifolium y C. annuum var. annuum. Kurtziana 22: 9–18.
CCDB · ipcn-api-dl — Chen, R. y., W. q. Song, X. l. Li, M. x. Li, G. l. Liang & C. b. Chen. 2003. Chromosome Atlas of Major Economic Plants Genome in China, Vol. 3, Chromosome Atlas of Garden Flowering Plants in China. Science Press, Beijing.
CCDB · book-ipcn66 — Shopova 1966
CCDB · book-ipcn67-71 — SHOPOVA, M. 1966. Non-synchronized meiotic division within an anther in Capsicum. Godisen Zbornik (Skopje univ.) Biol. 17-18: 113-116.
CCDB · book-ipcn67-71 — NOVAK, F., & J, BETLACH. 1970. Meiotic irregularities in pollen sterile sweet pepper (Capsicum~ L.). Cytologia 35: 335-343.
CCDB · book-ipcn67-71 — DATTA, P.C. 1968. Karyology of Indian varieties of Capsicum annuum Linn. (Solanaceae). Caryologia 21: 121-126.
CCDB · book-ipcn75-78 — Sopova 1967
CCDB · book-ipcn75-78 — Hindakova 1978
CCDB · book-ipcn73-74 — FRITSCH, R. 1970. Chromosomenzahlen von Pflanzen der Insel Kuba. I. Kulturpflanze 18: 189-197.
CCDB · book-indian_vol1 — Vilmorin, R. de & Simonet, M. 1928 ;. Huskins, C.L. & La Cour, L. 1930 ~ Sugiura, T. 1931, 1936b; Yamamoto, K. & Sakai, K. 1932 ; Tokunaga, K. 1934 ; Pal, B. B. et al. 1941 ; Janaki Ammal, E.K. (D. 1945) ; Delay, C. 1947 ; Sinha, N.P. 1950a ; Smith, P.G. & Heiser, C.B. 1951, 1957; Heiser, C.B. & Smith, P.G. 1953 ; Pichenot, M. 1959; Ohta, Y. 1961, 1962a, b; Shopova, M. 1966b, c; Baquar, S.R. et al. 1966; Baquar, S.R. 1967a; Novak, F. & Betlach, J. 1970; Gill, L.S. 1972; Reddi, M.V. & Rao, G.M. 1974; Katiyar, R.B. 1977, 1978; Lakshmi, N. & Rao, N.B. 1977b, 1978 ; Joshi, M.M. & Khalatkar, A.S. 1978 ; Mehetre, S.S. et al. 1979; Meshram, L.D. 1979 ; Bir, S.S. & Neelam 1980; Sadanandam, A. et al. 1981
CCDB · book-indian_vol1 — Datta, P.C. 1968
CCDB · book-indian_vol1 — Greenleaf, W.H. 1947; Sinha, N.P. 1950a; Smith, P.G. & Heiser, C.B. 1951, 1957; Heiser, C.B. & Smith, P.G. 1953 ; Morgan, D.T. & Rappleye, R.D. 1954; Ohta, Y. 1961, 1962a, b; Raghuvanshi, S.S. & Joshi, S. 1964; Raman, V.S. et al. 1964 ; Shopova, M. 1966b, c; von Reinhard, F. 1970
CCDB · book-fedorov — Sinha 1950a
CCDB · book-fedorov — Vilmorin, Simonet 1928
CCDB · book-fedorov — Huskins, La Cour 1930
+17 more references
2n 127×CCDB · ipcn-api-dl · CCDB · book-ipcn75-78 · CCDB · book-indian_vol1 +1
CCDB · ipcn-api-dl — Meshram, L. D., M. N. Narkhede & N. Y. Deshmukh. 1981. Spontaneous multiple translocations in Capsicum annuum L. Cytologia 46: 75–79.
CCDB · book-ipcn75-78 — Indira & Abraham 1977
CCDB · book-ipcn75-78 — Bapa & Lakshmi 1977
CCDB · book-indian_vol1 — Kostoff, D. 1926 (Tischler, G. 1927) ~ Christensen & Bamford (Fedorov) ~ Milovidov, P. 1960; Thombre, M.V. & Mehetre, S.S. 1979
CCDB · book-fedorov — KocTou 1926 (T. 1927)
CCDB · book-fedorov — Christensen, Bamford 1943
CCDB · book-fedorov — Milovidov 1960
2n 221×CCDB · book-indian_vol1
CCDB · book-indian_vol1 — Lakshmi, N. et al. 1978
2n 251×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Lakshmi, N., I. Harini & N. S. Prakash. 1990. Cytological behaviour of primary trisomics in Capsicum annuum L. J. Cytol. Genet. 25: 91–96.
2n 261×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Lakshmi, N. & P. Nalini. 1987. Cytology of a tetrasomic plant of Capsicum annuum L. Curr. Sci. 56: 1181–1182.
2n 361×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Lakshmi, N., P. Nalini & T. Srivalli. 1994. Cytogenetical studies on some auto and asynaptic triploids obtained in an intervarietal cross male sterile x X206 of Capsicum annuum L. Proc. Indian Natl. Sci. Acad., B 60: 151–156.
n 1223×CCDB · solan · CCDB · ipcn-api-dl · CCDB · book-ipcn66 +4
CCDB · solan
CCDB · ipcn-api-dl — Prakash, N. S., N. Lakshmi & I. Harini. 1988. Cytological effects of agricultural chemicals II. Effects of fungicides "Bavistin" and "Deltan" on chilli (Capsicum annuum L.). Cytologia 53: 709–715.
CCDB · ipcn-api-dl — Bir, S. S., S. Kumari, S. P. Shoree & M. S. Sagoo. 1978. Cytological studies in certain Bicarpellatae from north and central India. J. Cytol. Genet. 13: 99–106.
CCDB · ipcn-api-dl — Lakshmi, N. & N. S. Murthy. 1983. A spontaneous triple translocation heterozygote in Capsicum annuum L. Sci. & Cult. 49: 325–326.
CCDB · ipcn-api-dl — Tanksley, S. D. 1984. Linkage relationships and chromosomal locations of enzyme-coding genes in pepper, Capsicum annuum. Chromosoma 89: 352–360.
CCDB · ipcn-api-dl — Meshram, L. D., M. N. Narkhede & N. Y. Deshmukh. 1981. Spontaneous multiple translocations in Capsicum annuum L. Cytologia 46: 75–79.
CCDB · ipcn-api-dl — Meshram, L. D., M. N. Narkhede & P. G. Sawarkar. 1981a. Induced triploidy in Capsicum annuum L. Sci. & Cult. 47: 334.
CCDB · ipcn-api-dl — Bir, S. S. & Neelam. 1980. In Chromosome number reports LXIX. Taxon 29: 711.
CCDB · ipcn-api-dl — Cequea. 2006. Identification of paracentric inversions in Capsicum annuum (Solanaceae). Cytologia 71(4): 325–330.
CCDB · ipcn-api-dl — Lydia Prasad, Y. & K. G. R. Rao. 1983. Meiosis in autotriploid Physalis pubescens L. Proc. Indian Sci. Congr. Assoc. 70(3–VI): 89.
CCDB · book-ipcn66 — Baquar et al. 1966
CCDB · book-ipcn72 — GILL, L.S. 1972. Chromosome numbers in West-Himalayan bicarpellate species II. Bull. Torrey Bot. Club 99: 36-38.
CCDB · book-ipcn67-71 — NOVAK, F., & J, BETLACH. 1970. Meiotic irregularities in pollen sterile sweet pepper (Capsicum~ L.). Cytologia 35: 335-343.
CCDB · book-ipcn67-71 — BAQUAR, S.R. 1967. Cytomorphological studies in the family Solanaceae from West Pakistan. Genetica 38: 388-397
CCDB · book-ipcn75-78 — Ramalingam 1977
CCDB · book-ipcn75-78 — Katiyar 1978
CCDB · book-ipcn75-78 — Vasudevan 1975
CCDB · book-ipcn73-74 — REDDI, M.V., & G.M. RAO. 1974. Somatic karyotype and chiasma frequency in Capsicum annuum L. Cytologia 39: 581-584.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
Sequencing statusassembly quality — how far to trust these numbers
Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.
Assembly levelComplete Genome
Completeness94% BUSCO
07Deep time~1.73 Ma lineage
How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.
At a glance
DNA clock origin1.73 Ma TimeTree
When this lineage existed
How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.
DNA clock origin
08Occurrence & distribution
Record type13 540 records
Wild obs. + sensor4 371
Museum / vouchered4 482
Cultivated / captive2 417
Other2 270
Origin
Native579
Introduced123
Range
Area of Occupancy AOO19 384 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy64% within 1 km
≤100 m 1 604≤1 km 455≤10 km 453>10 km 703
3 215 georeferenced · 1 156 without coordinates
Open the mapobservation + sensor4 371
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy83% within 1 km
≤100 m 1 323≤1 km 138≤10 km 259>10 km 40
1 760 georeferenced · 2 722 without coordinates
Open the institutions mapphysical evidence4 482
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy5% within 1 km
≤100 m 1≤1 km 34≤10 km 163>10 km 502
700 georeferenced · 1 717 without coordinates
Open the mapnot free-living2 417
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions147 of 309 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Chapingo, MX | 406 |
| Durango, MX | 277 |
| Saint Louis, US | 190 |
| Instituto de Recursos Genéticos y Productividad, Colegio de Postgraduados, Campus Montecillolocation not on record | 177 |
| Instituto Amazónico de Investigaciones Científicas - SINCHIlocation not on record | 159 |
| Mexico City, MX | 155 |
| Mérida, MX | 142 |
| POL003location not on record | 123 |
| Juriquilla, MX | 91 |
| National Biodiversity Institute, Costa Ricalocation not on record | 89 |
| ROM007location not on record | 73 |
| Austin, US | 73 |
| HUN003location not on record | 69 |
| NLD037location not on record | 66 |
| MKD001location not on record | 64 |
| South Kensington, GB | 62 |
| Tapachula, MX | 58 |
| Puerto Ayora, EC | 58 |
| MeiseBGlocation not on record | 52 |
| Kew, GB | 51 |
| Beijing, CN | 50 |
| Bronx, US | 46 |
| SLU Artdatabankenlocation not on record | 45 |
| Universidad Juárez Autónoma de Tabascolocation not on record | 43 |
| Bloomington, US | 40 |
| UChlocation not on record | 38 |
| Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record | 34 |
| Tlalnepantla, MX | 31 |
| Mérida, MX | 31 |
| Antiguo Cuscatlán, SV | 29 |
| Guasave, MX | 29 |
| WAGlocation not on record | 29 |
| Olocation not on record | 28 |
| University of Stellenboschlocation not on record | 27 |
| Tepatitlán de Morelos, MX | 27 |
| Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record | 22 |
| Guilin, CN | 21 |
| Baroda, IN | 20 |
| Universidad Nacional de Colombia (UNAL)location not on record | 20 |
| ESP026location not on record | 19 |
| LDlocation not on record | 19 |
| Guangzhou, CN | 19 |
| Chongqing Museumlocation not on record | 18 |
| Chengdu, CN | 18 |
| HNBlocation not on record | 17 |
| Philadelphia, US | 17 |
| Miami, US | 17 |
| Auckland, NZ | 16 |
| Universidad Católica de Oriente (UCO)location not on record | 16 |
| Museo Entomologico de Leonlocation not on record | 15 |
| Guatemala, GT | 15 |
| Tuxtla Gutiérrez, MX | 15 |
| Universidad de Nariño (UdeNar)location not on record | 15 |
| Berlin, DE | 14 |
| Texas Lutheran Universitylocation not on record | 14 |
| Stockholm, SE | 13 |
| Centro Cultural Santo Domingolocation not on record | 13 |
| Riverside, US | 13 |
| Wuhan, CN | 13 |
| Millersville, US | 12 |
| UFPIlocation not on record | 12 |
| Nanjing, CN | 12 |
| San Diego, US | 12 |
| Elocation not on record | 12 |
| Sanda, JP | 11 |
| Yaoundé, CM | 11 |
| Puebla, MX | 11 |
| La Paz, MX | 11 |
| Yangling, CN | 11 |
| Oskarshamn, SE | 10 |
| Leiden University Medical Centerlocation not on record | 9 |
| CICYTEXlocation not on record | 9 |
| LBVlocation not on record | 9 |
| Instituto para la Investigación y la Preservación del Patrimonio Cultural y Natural del Valle del Cauca - INCIVAlocation not on record | 9 |
| Jardín Botánico de Cartagena "Guillermo Piñeres" (JBC)location not on record | 9 |
| MEXUlocation not on record | 9 |
| BGR001location not on record | 9 |
| Sociedad para el Estudio de los Recursos Bióticos de Oaxaca, A. C.location not on record | 8 |
| Taipei, TW | 8 |
| Tuxtla Gutiérrez, MX | 8 |
| Madison, US | 8 |
| Universidad de Caldas (UCaldas)location not on record | 7 |
| Palmerston, AU | 7 |
| 云南省思茅市民族传统医药研究所location not on record | 7 |
| Zhengzhou, CN | 7 |
| BRC Vegetable species, INRA Avignon (FRA011)location not on record | 7 |
| Moscow State Universitylocation not on record | 7 |
| ESP198location not on record | 7 |
| HRV044location not on record | 7 |
| UNICAMPlocation not on record | 7 |
| Area de Conservacion Guanacastelocation not on record | 6 |
| Dresden, DE | 6 |
| National Natural History Collectionslocation not on record | 6 |
| Instituto de Investigaciones Biológicas, Universidad Veracruzana, Región Xalapalocation not on record | 6 |
| Universidad de La Salle (La Salle)location not on record | 6 |
| Mexico City, MX | 6 |
| MAlocation not on record | 6 |
| Tartu, EE | 6 |
| Chicago, US | 5 |
| Tampa, US | 5 |
| Barcelona, ES | 5 |
| Université du Lomélocation not on record | 5 |
| EL PASO, US | 5 |
| Bangkok, TH | 5 |
| Adelaide, AU | 5 |
| Davis, US | 5 |
| Instituto de Ecología Aplicada, Universidad Autónoma de Tamaulipaslocation not on record | 5 |
| SXTCMlocation not on record | 5 |
| Lanzhou, CN | 5 |
| Changsha, CN | 5 |
| 盐城国家级珍禽自然保护区location not on record | 5 |
| Fort Worth, US | 5 |
| Herbier National du Gabonlocation not on record | 5 |
| UNEMATlocation not on record | 5 |
| AZE015location not on record | 4 |
| ASUlocation not on record | 4 |
| Parc Botanique et Zoologique de Tsimbazaza (PBZT)location not on record | 4 |
| Universidad Tecnológica del Chocó (UTCH)location not on record | 4 |
| Instituto Tecnológico del Valle de Oaxacalocation not on record | 4 |
| Jinghong, CN | 4 |
| Corporación Autónoma Regional Para la Defensa de la Meseta de Bucaramanga (CDMB)location not on record | 4 |
| Loja, EC | 4 |
| Guatemala City, GT | 4 |
| Columbia, US | 4 |
| Altos de Pipe, VE | 4 |
| BISHlocation not on record | 4 |
| Provincia di Livornolocation not on record | 4 |
| Centre Suisse de Recherches Scientifiques en Côte d’Ivoirelocation not on record | 4 |
| BAYLUlocation not on record | 4 |
| DNSMlocation not on record | 4 |
| Jaén, ES | 3 |
| Ciudad de México, MX | 3 |
| Mount Annan, AU | 3 |
| BDBClocation not on record | 3 |
| Tuscaloosa, US | 3 |
| New Haven, US | 3 |
| Austin, US | 3 |
| Honolulu, US | 3 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 3 |
| Universität Göttingenlocation not on record | 3 |
| Canberra, AU | 3 |
| Riobamba, EC | 3 |
| Xining, CN | 3 |
| Xiamen, CN | 3 |
| National Institute of Biological Resourceslocation not on record | 3 |
| Córdoba, AR | 3 |
| Guangzhou, CN | 3 |
| BFLlocation not on record | 3 |
| Giardini Botanici Hanburylocation not on record | 3 |
| UnBlocation not on record | 3 |
| Karlsruhe, DE | 3 |
| Tsukuba, JP | 3 |
| CJBGlocation not on record | 3 |
| Masindi, UG | 3 |
| Entomological Society of Latvialocation not on record | 3 |
| San Francisco de Campeche, MX | 3 |
| Kensington, AU | 3 |
| Centro de Investigación en Biodiversidad y Conservación, Universidad Autónoma del Estado de Moreloslocation not on record | 3 |
| Frankfurt am Main | 3 |
| Universidade Federal de Sergipe (UFS)location not on record | 3 |
| BMlocation not on record | 3 |
| Oulu, FI | 3 |
| Herbario Selva Central Oxapampa - estación biológica del Jardín Botánico de Missourilocation not on record | 2 |
| Université de Strasbourglocation not on record | 2 |
| SVK001location not on record | 2 |
| San Luis Potosí, MX | 2 |
| CNF-UFHBlocation not on record | 2 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 2 |
| Taipei, TW | 2 |
| PUC-RSlocation not on record | 2 |
| Northridge, US | 2 |
| Burlington, US | 2 |
| Istituto Agrario Castelnuovolocation not on record | 2 |
| Museum Of Natural And Environmental History, Shizuokalocation not on record | 2 |
| Laboratorio de Ictiologialocation not on record | 2 |
| Denver, US | 2 |
| UIBlocation not on record | 2 |
| Staten Island, US | 2 |
| Universidad Pedagógica y Tecnológica de Colombia (UPTC)location not on record | 2 |
| ROM023location not on record | 2 |
| Clemson, US | 2 |
| UEPAlocation not on record | 2 |
| Universidad del Valle (UV)location not on record | 2 |
| Santarém, BR | 2 |
| Ensenada, MX | 2 |
| Paris, FR | 2 |
| Pretoria, ZA | 2 |
| Universiti Sains Malaysialocation not on record | 2 |
| Departamento de Sistematica e Ecologialocation not on record | 2 |
| Cuenca, EC | 2 |
| Gump Stationlocation not on record | 2 |
| College Park, US | 2 |
| Museu Paraense Emílio Goeldilocation not on record | 2 |
| Plocation not on record | 2 |
| Chapel Hill, US | 2 |
| HUAlocation not on record | 2 |
| ENTClocation not on record | 2 |
| Villa de Etla, MX | 2 |
| Wlocation not on record | 2 |
| UTPLlocation not on record | 2 |
| Linares, MX | 2 |
| Phoenix, US | 2 |
| Bern, CH | 2 |
| Herbarium of the Department of Botany, University of Tokyolocation not on record | 2 |
| Universidad de El Salvadorlocation not on record | 2 |
| La Paz, BO | 2 |
| FUNEDlocation not on record | 2 |
| Pondicherry, IN | 2 |
| XAJDlocation not on record | 2 |
| Seoul, KR | 2 |
| Pontificia Universidad Javeriana (PUJ)location not on record | 2 |
| Cambridge, US | 2 |
| Nishihara, JP | 2 |
| Instituto para la Investigación y la Preservación del Patrimonio Cultural y Natural del Valle del Cauca - INCIVAlocation not on record | 2 |
| BIO-UNIPIlocation not on record | 2 |
| 河南豫北黄河故道湿地鸟类国家级自然保护区location not on record | 2 |
| LSF/FSA/UAClocation not on record | 2 |
| San José, CR | 2 |
| Universidad Industrial de Santander (UIS)location not on record | 2 |
| Green Bay, US | 1 |
| Vancouver, CA | 1 |
| Rotorua, NZ | 1 |
| Universidade Federal do Ceara, Departamento de Biologialocation not on record | 1 |
| Cincinnati, US | 1 |
| Santiago de Cali, CO | 1 |
| UPNlocation not on record | 1 |
| San Angelo, US | 1 |
| Universidad Surcolombiana (USCO)location not on record | 1 |
| Haramaya Universitylocation not on record | 1 |
| Limbe Botanical & Zoological Gardenslocation not on record | 1 |
| QCNElocation not on record | 1 |
| Universidad Distrital Francisco José de Caldas (UDistrital)location not on record | 1 |
| Salamanca, ES | 1 |
| BRNUlocation not on record | 1 |
| Universidad de Córdoba (UniCórdoba)location not on record | 1 |
| Institute of Botany, Ilia State Universitylocation not on record | 1 |
| Institut fur Allgemeine Mikrobiologielocation not on record | 1 |
| Logan, US | 1 |
| Institute of Applied Ecology, Academia Sinicalocation not on record | 1 |
| Addis Ababa, ET | 1 |
| Wuhan, CN | 1 |
| Awka, NG | 1 |
| Tamil Nadu Agricultural Universitylocation not on record | 1 |
| Jardín Botánico José Celestino Mutis (JBBJCM)location not on record | 1 |
| Jiangxi College of Educationlocation not on record | 1 |
| Xinxiang, CN | 1 |
| Jiujiang Forestry Institutelocation not on record | 1 |
| Universidad de Guayaquillocation not on record | 1 |
| Claremont, US | 1 |
| EAlocation not on record | 1 |
| Salzburg, AT | 1 |
| PHlocation not on record | 1 |
| Station d'Ecologie de Lamtolocation not on record | 1 |
| Jishou Universitylocation not on record | 1 |
| Universidad de Pamplona (UPamplona)location not on record | 1 |
| Post Graduate College Bannulocation not on record | 1 |
| SMMUlocation not on record | 1 |
| Porto Alegre, BR | 1 |
| Christchurch, NZ | 1 |
| Hangzhou, CN | 1 |
| Universidad Autónoma de Nayaritlocation not on record | 1 |
| OTSlocation not on record | 1 |
| Zacatecas, MX | 1 |
| Sociedad Para el Estudio de los Recursos Bioticos de Oaxacalocation not on record | 1 |
| Qarshi Botanical Gardenlocation not on record | 1 |
| Valparaiso, CL | 1 |
| Toluca, MX | 1 |
| Brasília, BR | 1 |
| Harvard Universitylocation not on record | 1 |
| TUR-Alocation not on record | 1 |
| Canadian Department of Agriculturelocation not on record | 1 |
| Feira de Santana, BR | 1 |
| WTUlocation not on record | 1 |
| Herbario MAT de la Universidad Politécnica Estatal del Carchilocation not on record | 1 |
| Otaru, JP | 1 |
| REALlocation not on record | 1 |
| Morelia, MX | 1 |
| Fundación Desarrollo y Ambiente FUNDAlocation not on record | 1 |
| ARM059location not on record | 1 |
| Albuquerque, US | 1 |
| Tula State Universitylocation not on record | 1 |
| San Luis Obispo, US | 1 |
| utaslocation not on record | 1 |
| DBF-NHMDlocation not on record | 1 |
| Porrentruy, CH | 1 |
| Mexico City, MX | 1 |
| Durban, ZA | 1 |
| Uppsala, SE | 1 |
| Nijmegen, NL | 1 |
| Porvoo, FI | 1 |
| Universidade Federal do Maranhãolocation not on record | 1 |
| Kyoto Universitylocation not on record | 1 |
| Santa Barbara, US | 1 |
| Kuopio, FI | 1 |
| UTFPR-CPlocation not on record | 1 |
| NHMJlocation not on record | 1 |
| Mlocation not on record | 1 |
| Santiago de Compostela, ES | 1 |
| Boise, US | 1 |
| TAIElocation not on record | 1 |
| HUENFlocation not on record | 1 |
| Edinburgh, GB | 1 |
| Wellington, NZ | 1 |
| Alicante, ES | 1 |
| Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record | 1 |
| Inner Mongolia Universitylocation not on record | 1 |
| Guangxi Institute of Traditional Medical and Pharmaceutical Scienceslocation not on record | 1 |
| LISClocation not on record | 1 |
| BioPlatformslocation not on record | 1 |
309 institutions · 4 136 of 4 482 vouchered records shown · 261 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA142 detections
Where the DNA of Capsicum annuum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found142
Studies independent surveys3
Countries12
Signal confidence: moderateweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 142 detections have coordinates
Open the map12 countries0
Cultivated LandGangapur PBRC
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median15.7 °C 12.6–25.1
Seasonal swing summer↔winter9.60 °C
Max temp (day)22.0 °C 16.4–29.6
Min temp (night)9.00 °C 7.40–21.1
Precipitation112 mm/mo 34.7–225
Air humidity58.0 % 50.9–68.0
Moisture balance21.7 mm/mo -93.3–90.4
Vapour deficit884 Pa 690–1,175
Wind speed2.90 m/s 1.50–4.10
Cloud cover25.5 % 23.8–48.7
CHELSA 1981–2010, ~9 km grid, at location & month of 99 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.