Capparis zeylanica

species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Brassicales/Capparaceae/Capparis

At a glance

Occurrence records337

Data sources10

Biological traits13

DNA specimens6

eDNA detections4

Sources10 archives

Databases and archives Capparis zeylanica's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility337 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources13 traits

Chemical compositionLOTUS4 compounds

Occurrence & distributionGBIF337 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD · NCBI6 specimens

Genome at a glanceCCDB2n = 40

01Narrative

Capparis zeylanica is een plantensoort uit de familie Capparaceae. De soort komt voor op het Indisch subcontinent en op Sri Lanka, in Indochina, Zuid- en Oost-China, Indonesië en de Filipijnen. Het is een klimheester die voorkomt in beboste gebieden.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Life cycle & reproduction3

Deciduousnessevergreen

Life formclimbing shrub or tree

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment5

Aquaticterrestrial

Climateseasonally dry tropical

Climberobligatory

Growth formshrub

⚠ sources differ — GIFT: shrub · TRY: climber

Woodinesswoody

Physiology & chemistry4

Leaf dry-matter content (LDMC)352 mg/g

Leaf n12.6 mg/g

Leaf p0.69 mg/g

Photosynthetic pathwayC3

03Chemical composition4 compounds

Compounds documented for Capparis zeylanica across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile3 classes

Unsaturated fatty acids2

Stigmastane steroids1

Glucosinolates1

Documented compounds4 total

Tissue Source Quantified only

Compound	Amount	Source
3-Metyl-3-butenyl glucosinolate	present	LOTUS
beta-Sitosterol	present	LOTUS
E-octadec-7-en-5-ynoic acid	present	LOTUS
Octadec-7-en-5-ynoic acid	present	LOTUS

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Capparis zeylanica has left across the world's sequence archives.

At a glance

DNA specimens6

Marker genes3

GenBank sequences10

eDNA detections4

Countries1

The DNA barcodea real sequence read deposited for this species

matKOL773434.1 ↗670 bp

ACGT

TGGAAGAATTTTTATACTCAAAAAAAATCCATTTTGAATACAAGATTTTTCTTGTTCTTATATAATTCTCATGTATGTGAATACGAATCC …

Capparis zeylanica voucher 402B maturase K (matK) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK10★rbcLtrnH-psbA

plant barcodemarker

06Genome at a glanceCCDB

The complete instruction manual Capparis zeylanica carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 40 n = 20

Ploidypolyploid inferred

Chromosome records40–442n range40median40mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 403×CCDB · book-indian_vol1 · CCDB · book-fedorov · CCDB · book-atlas-flowering-plants

CCDB · book-indian_vol1 — Raghavan, T.S. & Venkatasubban, K.R. 1941a

CCDB · book-fedorov — Raghavan T. S., Venkatasubban 1941a

CCDB · book-atlas-flowering-plants — Raghavan &V'41a

2n 441×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Subramanian, D. & G. Susheela. 1988. Cytotaxonomical studies of south Indian Capparidaceae. Cytologia 53: 679–684.

n 201×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Singhal, V. K. & B. S. Gill. 1984. SOCGI plant chromosome number reports -- II. J. Cytol. Genet. 19: 115–117.

n 221×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Subramanian, D. & G. Susheela. 1988. Cytotaxonomical studies of south Indian Capparidaceae. Cytologia 53: 679–684.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type337 records

Wild obs. + sensor184

Museum / vouchered153

Range

Area of Occupancy AOO912 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy63% within 1 km

≤100 m 37≤1 km 29≤10 km 23>10 km 16

105 georeferenced · 79 without coordinates

Open the mapobservation + sensor184

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy76% within 1 km

≤100 m 2≤1 km 24≤10 km 8

34 georeferenced · 119 without coordinates

Open the institutions mapphysical evidence153

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Baroda, IN	31
Guangzhou, CN	16
Pondicherry, IN	10
Bronx, US	7
Guilin, CN	6
Kunming, CN	5
Dehra Dun, IN	4
South Kensington, GB	4
Paris, FR	3
Cambridge University Herbariumlocation not on record	3
LDlocation not on record	2
Philadelphia, US	1
Xiamen, CN	1
Saint Louis, US	1
Department of Plant Resources, National Herbarium and Plant Laboratorieslocation not on record	1
Gujarat Biodiversity Gene Banklocation not on record	1
Vietnam Academy of Science and Technology (VAST)location not on record	1
Servico de Microbiologia e Imunologialocation not on record	1

18 institutions · 98 of 153 vouchered records shown · 55 without an institution code

09Environmental DNA4 detections

Where the DNA of Capparis zeylanica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.5 °C 23.5–23.5

Seasonal swing summer↔winter8.10 °C

Max temp (day)29.8 °C

Min temp (night)18.2 °C

Precipitation16.5 mm/mo

Air humidity46.0 %

Moisture balance-118 mm/mo

Vapour deficit1,555 Pa

Wind speed2.90 m/s

Cloud cover7.20 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)