Capparis rheedei

DC. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Brassicales/Capparaceae/Capparis

At a glance

Occurrence records23

Data sources3

Biological traits12

DNA specimens0

eDNA detections0

Sources3 archives

Databases and archives Capparis rheedei's data was compiled from.

GBIFGlobal Biodiversity Information Facility23 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements2 literature sources12 traits

Occurrence & distributionGBIF23 records

DNA & barcodingNCBIsequences

02Traits & measurements

SourcesWCVPGIFT

Size & morphology4

Plant height2.1 m

Seed mass120 mg

Seed mass max120 mg

Seed mass min120 mg

Life cycle & reproduction3

Dispersal typeanimal

Life formshrub or tree

Life spanperennial

Habitat & environment4

Climateseasonally dry tropical

Climberself-supporting

Growth formtree

Woodinesswoody

Physiology & chemistry1

Photosynthetic pathwayC3

05DNA & barcoding3 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Capparis rheedei has left across the world's sequence archives.

At a glance

Marker genes3

GenBank sequences3

The DNA barcodea real sequence read deposited for this species

ITSMN396791.1 ↗718 bp

ACGT

CTGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGTCCCGAGACGGAACGACCCGAGAACGAGTGCCTCGAACGCGGCGGGCCCCC …

Capparis baducca voucher Capp483 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type23 records

Wild obs. + sensor16

Museum / vouchered7

Range

Area of Occupancy AOO48 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy81% within 1 km

≤100 m 12≤1 km 1≤10 km 3

16 georeferenced

Open the mapobservation + sensor16

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced · 6 without coordinates

Open the institutions mapphysical evidence7

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pondicherry, IN	6
South Kensington, GB	1

2 institutions · 7 of 7 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)