Capparis mitchellii

Lindl. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Brassicales/Capparaceae/Capparis

At a glance

Occurrence records2 731

Data sources10

Biological traits42

DNA specimens6

eDNA detections2

Sources10 archives

Databases and archives Capparis mitchellii's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 731 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources42 traits

Chemical compositionLOTUS4 compounds

Occurrence & distributionGBIF2 731 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI6 specimens

01Narrative

Capparis mitchellii The wild orange is an Australian native plant found in dry inland areas of Australia. Its scientific name is Capparis mitchellii. It is not related to oranges, nor to the Osage-orange which is known as "wild orange" in North America, but to capers. Used by Aboriginal Australians as bush tucker long before European settlement in Australia, the fruit is a good source of vitamin C and may be enjoyed raw or in sweet and savoury dishes.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTAusTraitsTRY

Size & morphology19

Fruit length50 mm

Fruit width50 mm

Leaf length50 mm

Leaf length max60 mm

Leaf length min30 mm

Leaf mass per area224 g/m2

Leaf size533 mm²

Leaf width18.5 mm

Leaf width max25 mm

Leaf width min10 mm

Petiole length1 cm

Plant height7 m

⚠ sources differ — GIFT: 7 m · AusTraits: 6 m · TRY: 60.05 m

Plant height max4 m

Plant height min3 m

Seed length8.5 mm

Seed mass107 mg

Seed mass max112 mg

Seed mass min104 mg

Seed width6.5 mm

Life cycle & reproduction8

Deciduousnessevergreen

Dispersal typeanimal

Flowering timeyynnnnnnnnny

Life formshrub or tree

Life spanperennial > 20 years

⚠ sources differ — TRY: perennial > 20 years · AusTraits: perennial · GIFT: perennial

Pollination syndromebird+insect+mammal

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessfleshy

Fruit typeberry

Growth formtree

⚠ sources differ — GIFT: tree · AusTraits: shrub tree · TRY: Tree

Leaf compoundnesssimple

Leaf shapeelliptical

Woodinesswoody

Physiology & chemistry4

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)3.98 mm²/mg

Wood density762 mg/cm³

03Chemical composition4 compounds

Compounds documented for Capparis mitchellii across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Glucosinolates4

Documented compounds4 total

Tissue Source Quantified only

Compound	Amount	Source
[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl] (1E)-2-methyl-N-sulfooxypropanimidothioate	present	LOTUS
[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl] (1Z,2S)-2-methyl-N-sulfooxybutanimidothioate	present	LOTUS
Glucocochlearin	present	LOTUS
Glucoputranjivin	present	LOTUS

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Capparis mitchellii has left across the world's sequence archives.

At a glance

DNA specimens6

Marker genes4

GenBank sequences4

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLKM895827.1 ↗553 bpAustralia

ACGT

AAGTGTTGGATTCAAAGCTGGTGTTAAAGAGTATAAATTGACTTATTATACTCCTGAATATGAAACCAAGGATACTGATATCTTGGCAGC …

Capparis mitchellii voucher 129308779 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL2★rbcLatrnH-psbA

plant barcodemarker

08Occurrence & distribution

Record type2 731 records

Wild obs. + sensor1 885

Museum / vouchered721

Cultivated / captive6

Other119

Origin

Native220

Range

Area of Occupancy AOO7 096 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy93% within 1 km

≤100 m 1 304≤1 km 66≤10 km 77>10 km 19

1 466 georeferenced · 419 without coordinates

Open the mapobservation + sensor1 885

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy36% within 1 km

≤100 m 155≤1 km 65≤10 km 264>10 km 127

611 georeferenced · 110 without coordinates

Open the institutions mapphysical evidence721

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy80% within 1 km

≤100 m 4≤10 km 1

5 georeferenced · 1 without coordinates

Open the mapnot free-living6

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 22 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	152
Adelaide, AU	127
Mount Annan, AU	99
Canberra, AU	91
Museo Entomologico de Leonlocation not on record	81
Palmerston, AU	60
Armidale, AU	37
Kensington, AU	14
NSW Dept of Planning, Industry and Environmentlocation not on record	13
John T. Waterhouse Herbariumlocation not on record	7
Smithfield, AU	5
James Cook Townsvillelocation not on record	4
BGPAlocation not on record	3
EL PASO, US	2
Brisbane Botanic Gardens, Queensland Herbariumlocation not on record	2
Hobart, AU	2
Kew, GB	1
Wollongong, AU	1
NSW Office of Environment and Heritagelocation not on record	1
San Jose State University, Museum of Birds and Mammalslocation not on record	1
University of Stellenboschlocation not on record	1
GZUlocation not on record	1

22 institutions · 705 of 721 vouchered records shown · 16 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA2 detections

Where the DNA of Capparis mitchellii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.0 °C 20.0–20.0

Seasonal swing summer↔winter13.9 °C

Max temp (day)25.7 °C 25.6–25.8

Min temp (night)14.6 °C 14.5–14.8

Precipitation56.6 mm/mo 53.8–59.4

Air humidity53.4 % 52.6–54.2

Moisture balance-78.7 mm/mo -85.8–-71.7

Vapour deficit1,137 Pa 1,107–1,167

Wind speed3.50 m/s 3.20–3.70

Cloud cover24.2 % 23.1–25.3

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Capparis mitchellii

At a glance

Sources10 archives

Size & morphology19

Life cycle & reproduction8

Diet & foraging1

Habitat & environment10

Physiology & chemistry4

Compound class profile1 class

Documented compounds4 total

At a glance

Record type2 731 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions12 of 22 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 731 records