Capparis lucida

(Banks ex DC.) Benth. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Brassicales/Capparaceae/Capparis

At a glance

Occurrence records599

Data sources7

Biological traits23

DNA specimens3

eDNA detections2

Sources7 archives

Databases and archives Capparis lucida's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility599 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources23 traits

Occurrence & distributionGBIF599 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI3 specimens

01Narrative

Capparis lucida là một loài thực vật có hoa trong họ Capparaceae. Loài này được Benth. mô tả khoa học đầu tiên năm 1863.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAusTraitsGIFTTRY

Size & morphology9

Fruit length37.5 mm

Fruit width37.5 mm

Leaf length65 mm

Leaf size15 925 mm²

Leaf width35 mm

Petiole length0.6 cm

Plant height12 m

Seed length6 mm

Seed width5.5 mm

Life cycle & reproduction4

Dispersal typeanimal

Flowering timeynnnyyyyyyyy

Life spanperennial

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessfleshy

Fruit typeberry

Growth formshrub

⚠ sources differ — GIFT: shrub · AusTraits: shrub tree

Leaf compoundnesssimple

Leaf shapeelliptical rhomboidal

Woodinesswoody

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Capparis lucida has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes2

GenBank sequences2

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLKU739585.1 ↗1 408 bp

ACGT

TAAAGCAAGTGTTGGATTCAAAGCTGGTGTTAAAGAGTATAAATTGACTTATTATACTCCTGAATATGAAACCAAGGATACTGATATCTT …

Capparis lucida voucher WIS:W.J. Hahn 6192 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1

plant barcode

08Occurrence & distribution

Record type599 records

Wild obs. + sensor45

Museum / vouchered493

Other61

Origin

Native13

Range

Area of Occupancy AOO1 268 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy93% within 1 km

≤100 m 17≤1 km 9≤10 km 1>10 km 1

28 georeferenced · 17 without coordinates

Open the mapobservation + sensor45

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy38% within 1 km

≤100 m 115≤1 km 31≤10 km 204>10 km 30

380 georeferenced · 113 without coordinates

Open the institutions mapphysical evidence493

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	202
Smithfield, AU	132
Museo Entomologico de Leonlocation not on record	52
Canberra, AU	26
Mount Annan, AU	14
University of Stellenboschlocation not on record	14
Palmerston, AU	8
James Cook Townsvillelocation not on record	4
John T. Waterhouse Herbariumlocation not on record	2
St. Augustine, TT	2
Adelaide, AU	2
Kew, GB	1
HAWlocation not on record	1
University of the Sunshine Coastlocation not on record	1
LDlocation not on record	1

15 institutions · 462 of 493 vouchered records shown · 31 without an institution code

09Environmental DNA2 detections

Where the DNA of Capparis lucida was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median26.9 °C 26.9–26.9

Seasonal swing summer↔winter5.30 °C

Max temp (day)27.5 °C

Min temp (night)26.2 °C

Precipitation230 mm/mo

Air humidity62.3 %

Vapour deficit1,328 Pa

Cloud cover49.6 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)