Capparis loranthifolia

Lindl. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Brassicales/Capparaceae/Capparis

At a glance

Occurrence records187

Data sources7

Biological traits35

DNA specimens5

eDNA detections3

Sources7 archives

Databases and archives Capparis loranthifolia's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility187 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources35 traits

Occurrence & distributionGBIF187 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD · NCBI5 specimens

01Narrative

Capparis loranthifolia là một loài thực vật có hoa trong họ Capparaceae. Loài này được Lindl. mô tả khoa học đầu tiên năm 1848.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFTTRY

Size & morphology14

Fruit length18 mm

Fruit width18 mm

Leaf length55 mm

Leaf length max70 mm

Leaf length min30 mm

Leaf width12.5 mm

Leaf width max10 mm

Leaf width min8 mm

Petiole length1.2 cm

Plant height8 m

Plant height max8 m

Plant height min2 m

Seed length7.5 mm

Seed width5.5 mm

Life cycle & reproduction7

Dispersal typeanimal

Flowering timennnnnnnnyyyn

Life formshrub or tree

Life spanperennial

Pollination syndromeinsect

Resprouting capacityfire_killed

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessfleshy

Fruit typeberry

Growth formtree

⚠ sources differ — GIFT: tree · AusTraits: shrub tree

Leaf compoundnesssimple

Leaf shapeelliptical obovate spathulate

Woodinesswoody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Capparis loranthifolia has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes3

GenBank sequences5

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLKM895856.1 ↗536 bpAustralia

ACGT

AAGTGTTGGATTCAAAGCTGGTGTTAAAGAGTATAAATTGACTTATTATACTCCTGAATATGAAACCAAGGATACTGATATCTTGGCAGC …

Capparis loranthifolia voucher 129308338 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL2★rbcLa

plant barcode

08Occurrence & distribution

Record type187 records

Wild obs. + sensor36

Museum / vouchered31

Other120

Origin

Native6

Range

Area of Occupancy AOO628 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy41% within 1 km

≤100 m 10≤1 km 4≤10 km 19>10 km 1

34 georeferenced · 2 without coordinates

Open the mapobservation + sensor36

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy45% within 1 km

≤100 m 9≤1 km 1≤10 km 9>10 km 3

22 georeferenced · 9 without coordinates

Open the institutions mapphysical evidence31

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museo Entomologico de Leonlocation not on record	7
Brisbane, AU	4
Mount Annan, AU	3
Brisbane Botanic Gardens, Queensland Herbariumlocation not on record	3
Palmerston, AU	3
James Cook Townsvillelocation not on record	2
Smithfield, AU	2
Adelaide, AU	1
University of Stellenboschlocation not on record	1
Armidale, AU	1
Canberra, AU	1

11 institutions · 28 of 31 vouchered records shown · 3 without an institution code

09Environmental DNA3 detections

Where the DNA of Capparis loranthifolia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.8 °C 19.8–20.8

Seasonal swing summer↔winter12.1 °C

Max temp (day)25.6 °C 25.5–26.4

Min temp (night)14.8 °C 14.4–15.6

Precipitation55.4 mm/mo 50.9–58.4

Air humidity54.6 % 52.5–56.0

Moisture balance-80.9 mm/mo -94.4–-67.4

Vapour deficit1,160 Pa 1,057–1,171

Wind speed3.40 m/s 3.00–4.10

Cloud cover25.6 % 25.2–26.1

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)