Capparis decidua

(Forssk.) Edgew. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Brassicales/Capparaceae/Capparis

At a glance

Occurrence records1 089

Data sources12

Biological traits22

DNA specimens7

eDNA detections3

Sources12 archives

Databases and archives Capparis decidua's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 089 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources22 traits

Chemical compositionLOTUS · NPASS24 compounds

Occurrence & distributionGBIF1 089 records

Environmental DNA1 datasets · 2 countries3 detections

DNA & barcodingBOLD · NCBI7 specimens

Genome at a glanceCCDB2n = 102

01Narrative

Capparis decidua, commonly known as karira, is a useful plant in its marginal habitat.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology4

Plant height4 m

Seed mass54.82 mg

⚠ sources differ — TRY: 54.82 mg · GIFT: 58.5 mg

Seed mass max58.5 mg

Seed mass min58.5 mg

Life cycle & reproduction4

Deciduousnessdeciduous

Life formshrub or tree

Life spanperennial

Raunkiær life formchamaephyte

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Elevation max1 300 m

Elevation min100 m

Epiphyteterrestrial

Growth formshrub

Woodinesswoody

Physiology & chemistry4

Leaf n25.1 mg/g

Leaf p0.7 mg/g

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

03Chemical composition24 compounds

Compounds documented for Capparis decidua across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Polyamines10

Flavonols5

Dihydroflavonols2

Lactones1

Fatty alcohols1

Documented compounds24 total

Tissue Source Quantified only

Compound	Amount	Source
(2R,3R)-2-(3,4-dihydroxyphenyl)-5,7-dihydroxy-3-[(2S,3S,4S,5S,6R)-3,4,5-trihydroxy-6-methyl-tetrahydropyran-2-yl]oxy-chroman-4-one	present	NPASS
(6R)-6-[(Z,1S)-1-hydroxynon-3-enyl]oxan-2-one	present	LOTUS
(8E,22E)-4-hydroxy-25,28-dimethoxy-2-oxa-11,15,20-triazatricyclo[22.2.2.13,7]nonacosa-1(27),3,5,7(29),8,22,24(28),25-octaene-10,21-dione	present	LOTUS
4-Hydroxy-25,26-dimethoxy-2-oxa-11,15,20-triazatricyclo[22.2.2.13,7]nonacosa-1(26),3,5,7(29),8,22,24,27-octaene-10,21-dione	present	LOTUS
4-Hydroxy-25,28-dimethoxy-2-oxa-11,15,20-triazatricyclo[22.2.2.13,7]nonacosa-1(27),3,5,7(29),8,22,24(28),25-octaene-10,21-dione	present	LOTUS
4-Hydroxy-25-methoxy-2-oxa-11,15,20-triazatricyclo[22.2.2.13,7]nonacosa-1(26),3,5,7(29),8,22,24,27-octaene-10,21-dione	present	LOTUS
4-Hydroxy-26-methoxy-2-oxa-11,16,20-triazatricyclo[22.2.2.13,7]nonacosa-1(26),3,5,7(29),8,22,24,27-octaene-10,21-dione	present	LOTUS
Astilbic acid	present	NPASS
Bergenin	present	NPASS
Capparidisine	present	LOTUS

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Capparis decidua has left across the world's sequence archives.

At a glance

DNA specimens7

Marker genes4

GenBank sequences10

eDNA detections3

Countries2

The DNA barcodea real sequence read deposited for this species

ITSMN396792.1 ↗744 bp

ACGT

GAAGTCCGCTGAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCT …

Capparis decidua voucher Capp478 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK4★rbcL5★rbcLa★ITS1

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Capparis decidua carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 102 n = 51

Ploidypolyploid inferred

Chromosome records44–1022n range73median102mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 442×CCDB · book-indian_vol1 · CCDB · book-fedorov

CCDB · book-indian_vol1 — Panikkar, A.O.N. 1962

CCDB · book-fedorov — Panikkar 1962 nurval

2n 1022×CCDB · ipcn-api-dl · CCDB · book-ipcn75-78

CCDB · ipcn-api-dl — Sharma, A. K. 1970. Annual report, 1967-1968. Res. Bull. Univ. Calcutta Cytogenetics Lab. 2: 1–50.

CCDB · book-ipcn75-78 — Sharma 1970

n 161×CCDB · iapt

CCDB · iapt — IAPT/IOPB Chromosome Data 19

n 201×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Khatoon, S. & S. I. Ali. 1993. Chromosome Atlas of the Angiosperms of Pakistan. Department of Botany, University of Karachi, Karachi.

n 221×CCDB · Cave1963

CCDB · Cave1963 — Panikkar 1962

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 089 records

Wild obs. + sensor935

Museum / vouchered153

Other1

Range

Area of Occupancy AOO3 312 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy69% within 1 km

≤100 m 135≤1 km 38≤10 km 34>10 km 42

249 georeferenced · 686 without coordinates

Open the mapobservation + sensor935

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy57% within 1 km

≤100 m 2≤1 km 28≤10 km 14>10 km 9

53 georeferenced · 100 without coordinates

Open the institutions mapphysical evidence153

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 23 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
QAUlocation not on record	25
Kew, GB	17
Baroda, IN	17
South Kensington, GB	17
Durango, MX	8
Saint Louis, US	5
University of Stellenboschlocation not on record	5
Uniwersytet Śląski w Katowicachlocation not on record	4
MeiseBGlocation not on record	4
Dehra Dun, IN	4
IFAN Ch. A. Dioplocation not on record	2
Rishon Le Zion, IL	2
Uppsala, SE	2
Government College University Lahore, Dr. Sultan Ahmad Herbariumlocation not on record	1
MAlocation not on record	1
University of Agriculture, Faisalabadlocation not on record	1
Moscow State Universitylocation not on record	1
Gujarat Biodiversity Gene Banklocation not on record	1
Bloomington, US	1
PRClocation not on record	1
Post Graduate College Bannulocation not on record	1
University of Sindh Jamshorolocation not on record	1
Université du Lomélocation not on record	1

23 institutions · 122 of 153 vouchered records shown · 31 without an institution code

09Environmental DNA3 detections

Where the DNA of Capparis decidua was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median30.6 °C 24.3–30.6

Seasonal swing summer↔winter22.1 °C

Max temp (day)34.5 °C 29.2–36.7

Min temp (night)21.9 °C 16.9–26.0

Precipitation26.9 mm/mo 11.9–119

Air humidity48.2 % 41.3–57.6

Moisture balance-115 mm/mo -167–-58.8

Vapour deficit1,765 Pa 1,510–2,486

Wind speed3.20 m/s 3.00–4.60

Cloud cover31.9 % 24.1–56.1

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Capparis decidua

At a glance

Sources12 archives

Size & morphology4

Life cycle & reproduction4

Diet & foraging1

Habitat & environment8

Physiology & chemistry4

Other traits1

Compound class profile5 classes

Documented compounds24 total

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 089 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions9 of 23 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 089 records