Capillipedium spicigerum

S.T.Blake · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Poaceae/Capillipedium

At a glance

Occurrence records1 485

Data sources10

Biological traits34

DNA specimens3

eDNA detections2

Sources10 archives

Databases and archives Capillipedium spicigerum's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 485 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources34 traits

Occurrence & distributionGBIF1 485 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB2n = 40

01Narrative

Capillipedium spicigerum, commonly known as scented-top grass, is a species of perennial grass in the family Poaceae that is native to Australia.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology11

Fruit length2.25 mm

Leaf length250 mm

Leaf size1 080 mm²

Leaf width6 mm

Leaf width max8 mm

Leaf width min5 mm

Plant height1.5 m

Plant height max5 m

Plant height min0.5 m

Seed length2.25 mm

Seed mass0.286 mg

Life cycle & reproduction8

Dispersal typeanimal

Flowering timeyynnnnnnnnny

Life formperennial

Life spanperennial

Pollination syndromewind

Raunkiær life formhemicryptophyte

Resprouting capacityresprouts

Sex typeandromonoecious

Diet & foraging1

Parasiteindependent

Habitat & environment11

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecaryopsis

Growth formherb

⚠ sources differ — GIFT: herb · AusTraits: graminoid herb

Habitat GIFTdense secondary shrub and ruderal vegetation

Leaf compoundnesssimple

Leaf shapelinear

Woodinessnon-woody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC4

Other traits1

Plant support typefree-standing

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Capillipedium spicigerum has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes3

GenBank sequences3

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSDQ005030.1 ↗573 bp

ACGT

CAAAACAGACCGCGAACGCGTCTCTCTTGCCGCCGGGCTTCGGCCCGGCCTAGGCCCCCGAGCCCCTTCCCGGGGCGGAGGGGCCGCCAA …

Capillipedium spicigerum voucher PI 301773 RSA internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL2★ITS1trnH-psbA

plant barcodefungal barcodemarker

06Genome at a glanceCCDB

The complete instruction manual Capillipedium spicigerum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 40 n = 20

Ploidypolyploid inferred

Chromosome records40–402n range40median40mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 403×CCDB · eflora · CCDB · Cave1957 · CCDB · Cave1963

CCDB · eflora

CCDB · Cave1957 — Celarier & Harlan

CCDB · Cave1963 — de Wet et al. 1961, 1963

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 485 records

Wild obs. + sensor767

Museum / vouchered504

Other214

Origin

Native76

Range

Area of Occupancy AOO4 332 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 591≤1 km 53≤10 km 16>10 km 27

687 georeferenced · 80 without coordinates

Open the mapobservation + sensor767

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy34% within 1 km

≤100 m 91≤1 km 29≤10 km 125>10 km 107

352 georeferenced · 152 without coordinates

Open the institutions mapphysical evidence504

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions17 of 26 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	177
Mount Annan, AU	69
Canberra, AU	58
Paris, FR	52
Museo Entomologico de Leonlocation not on record	39
Université de Strasbourglocation not on record	22
Palmerston, AU	15
Armidale, AU	8
Kew, GB	7
Smithfield, AU	7
Hobart, AU	6
John T. Waterhouse Herbariumlocation not on record	6
J.F.Oberlin Universitylocation not on record	5
Saint Louis, US	4
James Cook Townsvillelocation not on record	3
Beijing, CN	3
BISHlocation not on record	3
Auckland, NZ	3
NSW Dept of Planning, Industry and Environmentlocation not on record	2
Nagano City, JP	2
TAIElocation not on record	2
Logan, US	2
Honolulu, US	1
University of the Sunshine Coastlocation not on record	1
Adelaide, AU	1
Taipei, TW	1

26 institutions · 499 of 504 vouchered records shown · 5 without an institution code

09Environmental DNA2 detections

Where the DNA of Capillipedium spicigerum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.0 °C 25.0–25.0

Seasonal swing summer↔winter8.90 °C

Max temp (day)27.2 °C

Min temp (night)22.7 °C

Precipitation162 mm/mo

Air humidity60.8 %

Moisture balance-46.6 mm/mo

Vapour deficit1,235 Pa

Wind speed5.40 m/s

Cloud cover30.4 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Capillipedium spicigerum

At a glance

Sources10 archives

Size & morphology11

Life cycle & reproduction8

Diet & foraging1

Habitat & environment11

Physiology & chemistry2

Other traits1

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 485 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions17 of 26 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 485 records