Cantharellus subalbidus

A.H.Sm. & Morse · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Cantharellales/Hydnaceae/Cantharellus

At a glance

Occurrence records1 117

Data sources9

Biological traits0

DNA specimens6

eDNA detections5

Sources9 archives

Databases and archives Cantharellus subalbidus's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 117 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 117 records

Environmental DNA1 datasets · 1 countries5 detections

DNA & barcodingBOLD · NCBI6 specimens

01Narrative

Cantharellus subalbidus, the white chanterelle, is a fungus native to California and the Pacific Northwest region of North America. It is a member of the genus Cantharellus along with other popular edible chanterelles. It is similar in appearance to other chanterelles except for its cream to white color and orange bruising. Cantharellus subalbidus may form a mycorrhizal association with species of pine, hemlock, Douglas-fir, and Pacific madrone. C. subalbidus has been found to be more common in old-growth forests than in younger forests.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cantharellus subalbidus has left across the world's sequence archives.

At a glance

DNA specimens6

Marker genes1

GenBank sequences10

eDNA detections5

Countries2

The DNA barcodea real sequence read deposited for this species

ITSMG938672.1 ↗220 bpUSA · 2012

ACGT

TCTTGGTCATTTAGGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCAACCCCTGTGGGTATAGTGAGATGGT …

Cantharellus subalbidus voucher MushroomObserver.org/87519 small subunit ribosomal RNA gene and internal transcribed spacer 1, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10

fungal barcode

08Occurrence & distribution

Record type1 117 records

Wild obs. + sensor1 018

Museum / vouchered99

Range

Area of Occupancy AOO3 196 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy39% within 1 km

≤100 m 225≤1 km 138≤10 km 186>10 km 390

939 georeferenced · 79 without coordinates

Open the mapobservation + sensor1 018

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy27% within 1 km

≤1 km 8≤10 km 17>10 km 5

30 georeferenced · 69 without coordinates

Open the institutions mapphysical evidence99

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
TENN-Flocation not on record	24
WTUlocation not on record	18
Vancouver, CA	10
Bronx, US	9
Bernard Price Institute for Palaeontological Researchlocation not on record	7
Universidad Nacional Autonoma de Mexico, Instituto de Biologialocation not on record	5
Mexico City, MX	4
ILLSlocation not on record	4
Chicago, US	2
Ann Arbor, US	2
National Mushroom Centre, Department of Agriculture, Ministry of Agriculture and Livestock, Bhutanlocation not on record	2
Department of Plant Resources, National Herbarium and Plant Laboratorieslocation not on record	2
Pullman, US	1

13 institutions · 90 of 99 vouchered records shown · 9 without an institution code

09Environmental DNA5 detections

Where the DNA of Cantharellus subalbidus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.5 °C 13.2–16.8

Seasonal swing summer↔winter5.90 °C

Max temp (day)17.8 °C 17.3–20.8

Min temp (night)8.00 °C 7.90–11.4

Precipitation313 mm/mo 161–340

Air humidity63.9 % 62.7–65.9

Moisture balance180 mm/mo 43.3–214

Vapour deficit572 Pa 543–683

Wind speed0.8 m/s 0.7–1.10

Cloud cover28.6 % 26.7–30.1

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Cantharellus subalbidus

At a glance

Sources9 archives

At a glance

Record type1 117 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions6 of 13 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 117 records