Cantharellus roseocanus — The Life Data

Fungi/Basidiomycota/Agaricomycetes/Cantharellales/Hydnaceae/Cantharellus

At a glance

Occurrence records659

Data sources8

Biological traits0

DNA specimens0

eDNA detections1

Sources8 archives

Databases and archives Cantharellus roseocanus's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility659 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF659 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingNCBIsequences

01Narrative

Cantharellus roseocanus is a species of fungus in the family Cantharellaceae. Found in the Pacific Northwest region of North America, it was originally described in 1997 as a variety of Cantharellus cibarius, and later promoted to distinct species status in 2012.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding10 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cantharellus roseocanus has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences10

eDNA detections1

Countries3

The DNA barcodea real sequence read deposited for this species

ITSKX828787.1 ↗423 bpCanada · 1995

ACGT

CTAACACCAAGCGAATCATCGAGTCTTTGAACGCAAACGGCACCCTTCCAGTCCATTCCAAAGCGGTGGCGGAGGATGAAGACAAGGGTA …

Cantharellus roseocanus voucher DAOM 220723 5.8S ribosomal RNA gene and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS10

fungal barcode

08Occurrence & distribution

Record type659 records

Wild obs. + sensor628

Museum / vouchered31

Range

Area of Occupancy AOO2 004 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy46% within 1 km

≤100 m 166≤1 km 87≤10 km 74>10 km 223

550 georeferenced · 78 without coordinates

Open the mapobservation + sensor628

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy67% within 1 km

≤100 m 1≤1 km 3>10 km 2

6 georeferenced · 25 without coordinates

Open the institutions mapphysical evidence31

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Denver, US	8
Chicago, US	5
Vancouver, CA	4
WTUlocation not on record	3
Laramie, US	3
Toronto, CA	2
Logan, US	1
Uppsala, SE	1

8 institutions · 27 of 31 vouchered records shown · 4 without an institution code

09Environmental DNA1 detections

Where the DNA of Cantharellus roseocanus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.