Cantharellus persicinus — The Life Data

Fungi/Basidiomycota/Agaricomycetes/Cantharellales/Hydnaceae/Cantharellus

At a glance

Occurrence records58

Data sources8

Biological traits0

DNA specimens2

eDNA detections0

Sources8 archives

Databases and archives Cantharellus persicinus's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility58 records↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF58 records

DNA & barcodingBOLD · NCBI2 specimens

01Narrative

Cantharellus persicinus, the peach or pink chanterelle, is a fungus native to the Appalachian region of eastern North America. Like other popular edible chanterelles, it is a member of the genus Cantharellus. It is suspected of being mycorrhizal, found in association with oaks and eastern hemlock. DNA analysis has shown C. persicinus to be a genetically valid species.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cantharellus persicinus has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes1

GenBank sequences3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKX896775.1 ↗303 bp

ACGT

CGGCACTTCTAATCTAACACCAAGCGAATCATCGAGTCTTTGAACGCAAACGGCACCCTTCCAGTCCATTCCAAAGCGGTTGGCGGAGGA …

Cantharellus persicinus voucher JJ/MO-CANT-4 (PC0142431) 5.8S ribosomal RNA gene and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS3

fungal barcode

08Occurrence & distribution

Record type58 records

Wild obs. + sensor34

Museum / vouchered24

Range

Area of Occupancy AOO184 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy48% within 1 km

≤100 m 5≤1 km 5≤10 km 8>10 km 3

21 georeferenced · 13 without coordinates

Open the mapobservation + sensor34

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy29% within 1 km

≤1 km 2≤10 km 3>10 km 2

7 georeferenced · 17 without coordinates

Open the institutions mapphysical evidence24

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
TENN-Flocation not on record	11
Davis and Elkins Collegelocation not on record	9
Chicago, US	3
Bronx, US	1

4 institutions · 24 of 24 vouchered records shown