Cantharellus lewisii

Buyck & V.Hofst. · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Cantharellales/Hydnaceae/Cantharellus

At a glance

Occurrence records163

Data sources8

Biological traits0

DNA specimens1

eDNA detections4

Sources8 archives

Databases and archives Cantharellus lewisii's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility163 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF163 records

Environmental DNA3 datasets · 1 countries4 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Cantharellus lewisii is a species of fungus in the family Cantharellaceae. Discovered in 2011, it is found in the Southeastern United States where it associates with floodplain hardwoods. Its name honours American mycologist David Lewis.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cantharellus lewisii has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences6

eDNA detections4

Countries1

The DNA barcodea real sequence read deposited for this species

ITSON366758.1 ↗271 bpUSA · 2018

ACGT

AGCAACCGGCCAGTTGGTCCGCGCTACTTGGTTGATCTCTGGACTCTTGTTTTGGATGTAAGGTAGGCATCCACAAGTGCGTTGGCGTGC …

Cantharellus lewisii voucher iNAT:16409184 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS6

fungal barcode

08Occurrence & distribution

Record type163 records

Wild obs. + sensor141

Museum / vouchered22

Range

Area of Occupancy AOO404 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy67% within 1 km

≤100 m 50≤1 km 16≤10 km 16>10 km 16

98 georeferenced · 43 without coordinates

Open the mapobservation + sensor141

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy60% within 1 km

≤100 m 1≤1 km 2≤10 km 1>10 km 1

5 georeferenced · 17 without coordinates

Open the institutions mapphysical evidence22

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Chicago, US	9
TENN-Flocation not on record	3
Colorado State Universitylocation not on record	3
Paris, FR	2
Purdue Universitylocation not on record	1
Baton Rouge, US	1

6 institutions · 19 of 22 vouchered records shown · 3 without an institution code

09Environmental DNA4 detections

Where the DNA of Cantharellus lewisii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys3

Countries1

Verifiable raw sequence linked2

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

Indomalayan

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.9 °C 25.9–25.9

Seasonal swing summer↔winter1.70 °C

Max temp (day)29.6 °C

Min temp (night)22.1 °C

Precipitation180 mm/mo

Air humidity67.2 %

Moisture balance32.6 mm/mo

Vapour deficit1,096 Pa

Wind speed1.90 m/s

Cloud cover50.3 %

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)