Cantharellus ferruginascens

P.D.Orton · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Cantharellales/Hydnaceae/Cantharellus

At a glance

Occurrence records417

Data sources7

Biological traits0

DNA specimens34

eDNA detections9

Sources7 archives

Databases and archives Cantharellus ferruginascens's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility417 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics34 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF417 records

Environmental DNA1 datasets · 0 countries9 detections

DNA & barcodingBOLD · NCBI34 specimens

01Narrative

Cantharellus ferruginascens, la Girolle ferrugineuse, est une espèce de la famille des Hydnaceae.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding34 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cantharellus ferruginascens has left across the world's sequence archives.

At a glance

DNA specimens34

Marker genes2

GenBank sequences10

eDNA detections9

Countries4

The DNA barcodea real sequence read deposited for this species

ITSKX828772.1 ↗217 bpFrance · 1993

ACGT

ATCTAACACCAAGCGAATCATCGAGTCTTTGAACGCAAACGGCACCCTTCCAGTCCATTCCAAAGCGGTGGCTGAGGATGAAGACAAGGG …

Cantharellus ferruginascens voucher Mornand 9312B2 5.8S ribosomal RNA gene and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10★ITS2

fungal barcode

08Occurrence & distribution

Record type417 records

Wild obs. + sensor344

Museum / vouchered71

Other2

Origin

Native2

Range

Area of Occupancy AOO1 064 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy32% within 1 km

≤100 m 56≤1 km 36≤10 km 155>10 km 38

285 georeferenced · 59 without coordinates

Open the mapobservation + sensor344

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy86% within 1 km

≤100 m 2≤1 km 34≤10 km 6

42 georeferenced · 29 without coordinates

Open the institutions mapphysical evidence71

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
San Sebastián, ES	21
Kew, GB	12
University of the Basque Country (UPV/EHU)location not on record	8
WU-MYClocation not on record	7
Bardejov, SK	6
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	3
Olocation not on record	2
TUR-Alocation not on record	2
MeiseBGlocation not on record	2
Natural History Museum, Tribhuvan Universitylocation not on record	2
BDBClocation not on record	1
Mlocation not on record	1
GJOlocation not on record	1
Gijón, ES	1
Staten Island, US	1
JA-CAGPDS-CAMlocation not on record	1

16 institutions · 71 of 71 vouchered records shown

09Environmental DNA9 detections

Where the DNA of Cantharellus ferruginascens was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found9

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 9 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)