Cantharellus enelensis

Voitk, Thorn, Lebeuf & J.I.Kim · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Cantharellales/Hydnaceae/Cantharellus

At a glance

Occurrence records556

Data sources6

Biological traits0

DNA specimens0

eDNA detections0

Sources6 archives

Databases and archives Cantharellus enelensis's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility556 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF556 records

DNA & barcodingNCBIsequences

01Narrative

Cantharellus enelensis is one of several species of chanterelle native to North America. It is a new member of the C. cibarius complex and wasn't discovered until 2017. Chanterelles identified with DNA sequencing as C. enelensis have been found in Newfoundland, Quebec, Michigan and Illinois but there is evidence to suggest it is widespread in North American conifer forests. It has been temporarily categorized as having a conservation status of 'least concern'. Members of the C. cibarius complex in eastern North America are difficult to distinguish from one another without special techniques such as DNA sequencing and microscopic examinations. C. enelensis is the most commonly found chanterelle in Newfoundland. C. enelensis is one of 40 varieties of Cantharellus that grows in North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding10 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cantharellus enelensis has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences10

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKX592727.1 ↗1 585 bpCanada · 2011

ACGT

TTTTTTTGGCCCGGCATGGACCTAGACCTACACGCGGTGCCCCTGTTCTTGACAGATTAGGTCTATAACATCAAGCTGAGTTTTCCAATG …

Cantharellus enelensis voucher MR3-021 (UWO) internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10

fungal barcode

08Occurrence & distribution

Record type556 records

Wild obs. + sensor477

Museum / vouchered79

Range

Area of Occupancy AOO1 720 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy68% within 1 km

≤100 m 213≤1 km 62≤10 km 53>10 km 79

407 georeferenced · 70 without coordinates

Open the mapobservation + sensor477

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced · 78 without coordinates

Open the institutions mapphysical evidence79

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
CA	31
Chicago, US	3

2 institutions · 34 of 79 vouchered records shown · 45 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)