Cantharellus cinnabarinus

(Schwein.) Schwein. · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Cantharellales/Hydnaceae/Cantharellus

At a glance

Occurrence records4 988

Data sources13

Biological traits0

DNA specimens2

eDNA detections135

Sources13 archives

Databases and archives Cantharellus cinnabarinus's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility4 988 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI135 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionLOTUS · NPASS27 compounds

Occurrence & distributionGBIF4 988 records

Environmental DNA3 datasets · 3 countries135 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceGoaT · NCBI≈62 Mbp

01Narrative

Cantharellus cinnabarinus Greek word meaning cup/ tankard or drinking vessel (or Cinnabar Red Chanterelle- ) is a fungus native to eastern North America. It is a member of the genus Cantharellus along with other chanterelles. It is named after its red color, which is imparted by the carotenoid canthaxanthin. It is edible and good, fruiting in association with hardwood trees in the summer and fall.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition27 compounds

Compounds documented for Cantharellus cinnabarinus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile4 classes

Flavan-3-ols15

Proanthocyanins8

Carotenoids (C40, β-β)2

Flavan-3-ols $ Proanthocyanins1

Documented compounds27 total

Tissue Source Quantified only

Compound	Amount	Source
(2R,3R)-5,7-Diacetoxy-2-(3,4,5-Triacetoxyphenyl)-3,4-Dihydro-2H-Chromen-3-Yl 3,4,5-Triacetoxybenzoate	present	NPASS
(2R,3R)-6-[(2R,3S,4S)-3,7-dihydroxy-2-(3,4,5-trihydroxyphenyl)-3,4-dihydro-2H-chromen-4-yl]-2-(3,4,5-trihydroxyphenyl)-3,4-dihydro-2H-chromene-3,5,7-triol	present	NPASS
(2R,3R)-8-[(2R,3S,4R)-3,7-dihydroxy-2-(3,4,5-trihydroxyphenyl)-3,4-dihydro-2H-chromen-4-yl]-2-(3,4,5-trihydroxyphenyl)-3,4-dihydro-2H-chromene-3,5,7-triol	present	NPASS
(2R,3R)-8-[(2R,3S,4S)-3,7-dihydroxy-2-(3,4,5-trihydroxyphenyl)-3,4-dihydro-2H-chromen-4-yl]-2-(3,4,5-trihydroxyphenyl)-3,4-dihydro-2H-chromene-3,5,7-triol	present	NPASS
(2R,3S)-6-[(2R,3S,4R)-3,7-dihydroxy-2-(3,4,5-trihydroxyphenyl)-3,4-dihydro-2H-chromen-4-yl]-2-(3,4,5-trihydroxyphenyl)-3,4-dihydro-2H-chromene-3,5,7-triol	present	NPASS
(2R,3S)-6-[(2R,3S,4S)-3,7-dihydroxy-2-(3,4,5-trihydroxyphenyl)-3,4-dihydro-2H-chromen-4-yl]-2-(3,4,5-trihydroxyphenyl)-3,4-dihydro-2H-chromene-3,5,7-triol	present	NPASS
(4alpha->8)-bis-4'-O-methylgallocatechin	present	NPASS
2,4,4-trimethyl-3-[(9E,11E,13E,15E,17E)-3,7,12,16-tetramethyl-18-(2,6,6-trimethyl-3-oxocyclohexen-1-yl)octadeca-1,3,5,7,9,11,13,15,17-nonaenyl]cyclohex-2-en-1-one	present	LOTUS
4'-O-Methyl-Gallocatechin	present	NPASS
[(2R,3R)-5,7-diacetyloxy-2-(3,4,5-triacetyloxyphenyl)-3,4-dihydro-2H-chromen-3-yl] 4-acetyloxy-3,5-dimethoxybenzoate	present	NPASS

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cantharellus cinnabarinus has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes2

GenBank sequences8

eDNA detections135

Countries3

The DNA barcodea real sequence read deposited for this species

ITSPV169472.1 ↗420 bpUSA · 2024

ACGT

GCACCTCTATCTAACACCAAGCGAATCATCGAGTCTTTGAACGCAAACGGCACCCTTCCAGTCCATTCCAAAGCGGTGGCGGCGGATGAA …

Cantharellus cinnabarinus isolate VACant14 5.8S ribosomal RNA gene and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS8★ITS1

fungal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Cantharellus cinnabarinus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈62 363 499 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

THIS GENOME Cantharellus cinnabarinus0.06 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

Completeness78.9% BUSCO

08Occurrence & distribution

Record type4 988 records

Wild obs. + sensor4 662

Museum / vouchered326

Range

Area of Occupancy AOO14 112 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy79% within 1 km

≤100 m 2 380≤1 km 630≤10 km 355>10 km 465

3 830 georeferenced · 832 without coordinates

Open the mapobservation + sensor4 662

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy68% within 1 km

≤100 m 75≤1 km 8≤10 km 33>10 km 6

122 georeferenced · 204 without coordinates

Open the institutions mapphysical evidence326

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 23 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bronx, US	138
Zapopan, MX	71
Chicago, US	43
Ann Arbor, US	21
Université de Montréal Biodiversity Centrelocation not on record	8
WTUlocation not on record	8
Helsinki, FI	4
Bando, JP	4
Osaka, JP	3
Adam Mickiewicz University in Poznańlocation not on record	3
KOMlocation not on record	3
National Institute of Biological Resourceslocation not on record	2
Tomioka, JP	2
Toronto, CA	2
Durango, MX	2
St. Paul, US	2
Paris, FR	2
Copenhagen, DK	2
KNAMlocation not on record	1
Stockholm, SE	1
IPA/SPlocation not on record	1
Purdue Universitylocation not on record	1
Olocation not on record	1

23 institutions · 325 of 326 vouchered records shown

09Environmental DNA135 detections

Where the DNA of Cantharellus cinnabarinus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found135

Studies independent surveys3

Countries3

Verifiable raw sequence linked1

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 135 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.8 °C 23.8–27.6

Seasonal swing summer↔winter5.80 °C

Max temp (day)29.2 °C 28.8–29.2

Min temp (night)19.8 °C 19.8–26.4

Precipitation45.5 mm/mo 45.5–121

Air humidity58.0 % 58.0–64.1

Moisture balance-101 mm/mo

Vapour deficit1,235 Pa 1,235–1,322

Wind speed2.30 m/s

Cloud cover30.2 % 30.2–31.2

CHELSA 1981–2010, ~9 km grid, at location & month of 133 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Cantharellus cinnabarinus

At a glance

Sources13 archives

Compound class profile4 classes

Documented compounds27 total

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type4 988 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions14 of 23 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type4 988 records