Cantharellus chicagoensis

Fungi/Basidiomycota/Agaricomycetes/Cantharellales/Hydnaceae/Cantharellus

At a glance

Occurrence records136

Data sources7

Biological traits0

DNA specimens6

eDNA detections0

Sources7 archives

Databases and archives Cantharellus chicagoensis's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility136 records↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF136 records

DNA & barcodingBOLD · NCBI6 specimens

01Narrative

Cantharellus chicagoensis, the Chicago chanterelle, is a species of Cantharellus from United States.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cantharellus chicagoensis has left across the world's sequence archives.

At a glance

DNA specimens6

Marker genes1

GenBank sequences5

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKP639200.1 ↗318 bpUSA

ACGT

AGTTGCATGGCACTTCTAATCTAACACCAAGCGAATCATCGAGTCTTTGAACGCAAACGGCACCCTTCCAGTCCATTCCAAAGCGGTGGC …

Cantharellus sp. PRL-2015 voucher PRL8332 5.8S ribosomal RNA gene and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS5

fungal barcode

08Occurrence & distribution

Record type136 records

Wild obs. + sensor121

Museum / vouchered15

Range

Area of Occupancy AOO420 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy54% within 1 km

≤100 m 26≤1 km 15≤10 km 11>10 km 24

76 georeferenced · 45 without coordinates

Open the mapobservation + sensor121

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy55% within 1 km

≤1 km 6≤10 km 5

11 georeferenced · 4 without coordinates

Open the institutions mapphysical evidence15

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Chicago, US	14
Purdue Universitylocation not on record	1

2 institutions · 15 of 15 vouchered records shown