Cantharellus cascadensis — The Life Data

Fungi/Basidiomycota/Agaricomycetes/Cantharellales/Hydnaceae/Cantharellus

At a glance

Occurrence records240

Data sources9

Biological traits0

DNA specimens2

eDNA detections3

Sources9 archives

Databases and archives Cantharellus cascadensis's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility240 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF240 records

Environmental DNA3 datasets · 0 countries3 detections

DNA & barcodingBOLD · NCBI2 specimens

01Narrative

Cantharellus cascadensis, the Cascade chanterelle, is a fungus native to the Pacific Northwest region of North America. It is a member of the genus Cantharellus along with other popular edible chanterelles. It is named after the Cascade Range, where it was formally described in 2003.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cantharellus cascadensis has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes1

GenBank sequences10

eDNA detections3

Countries2

The DNA barcodea real sequence read deposited for this species

ITSKX592705.1 ↗375 bpCanada · 2011

ACGT

ACCGGTTGGTTAGCTGGGGATTGGGCTTGCTTGGGGCGATTGCTCTGGCTTGCCTTAAAATCAAGCGTTGTGTGGATTGGACTTTCAAGC …

Cantharellus cascadensis voucher UBC F23801 internal transcribed spacer 2 and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS10

fungal barcode

08Occurrence & distribution

Record type240 records

Wild obs. + sensor233

Museum / vouchered7

Range

Area of Occupancy AOO824 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy34% within 1 km

≤100 m 47≤1 km 22≤10 km 34>10 km 100

203 georeferenced · 30 without coordinates

Open the mapobservation + sensor233

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 2

2 georeferenced · 5 without coordinates

Open the institutions mapphysical evidence7

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Vancouver, CA	3
Chicago, US	1
Santa Cruz, US	1

3 institutions · 5 of 7 vouchered records shown · 1 without an institution code

09Environmental DNA3 detections

Where the DNA of Cantharellus cascadensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys3

Verifiable raw sequence linked2

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.