Cantharellus californicus

D.Arora & Dunham · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Cantharellales/Hydnaceae/Cantharellus

At a glance

Occurrence records1 489

Data sources9

Biological traits0

DNA specimens3

eDNA detections2

Sources9 archives

Databases and archives Cantharellus californicus's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 489 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 489 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI3 specimens

01Narrative

Cantharellus californicus, sometimes called the mud puppy or oak chanterelle, is a fungus native to California, United States. It is a member of the genus Cantharellus along with other popular edible chanterelles. It is generally similar in appearance to C. cibarius and C. formosus except for its large size at maturity; individual specimens larger than 1 kg are reported, making it the largest known species of chanterelle. Their unusual size is due in part to their capacity for indeterminate growth, making Cantharellus californicus specimens actively grow for far longer than most other mushrooms.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cantharellus californicus has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes2

GenBank sequences3

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSDQ974688.1 ↗384 bp

ACGT

CCTTCCAGTCCATTCCAAAGCGGTGGCGGAGGATGAAGACAAGGGTATCTCTGGCTGAGGGTAATGGAAACTGATCCAGTGTACCCACTG …

Cantharellus californicus voucher src46 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS3★ITS2

fungal barcode

08Occurrence & distribution

Record type1 489 records

Wild obs. + sensor1 484

Museum / vouchered5

Range

Area of Occupancy AOO3 320 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy43% within 1 km

≤100 m 427≤1 km 149≤10 km 191>10 km 559

1 326 georeferenced · 158 without coordinates

Open the mapobservation + sensor1 484

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤1 km 1≤10 km 1

2 georeferenced · 3 without coordinates

Open the institutions mapphysical evidence5

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
WTUlocation not on record	1
Logan, US	1
Chicago, US	1
Vancouver, CA	1

4 institutions · 4 of 5 vouchered records shown · 1 without an institution code

09Environmental DNA2 detections

Where the DNA of Cantharellus californicus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.4 °C 12.4–12.4

Seasonal swing summer↔winter10.0 °C

Max temp (day)17.2 °C

Min temp (night)8.00 °C

Precipitation109 mm/mo

Air humidity55.3 %

Moisture balance35.5 mm/mo

Vapour deficit643 Pa

Wind speed2.80 m/s

Cloud cover38.3 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Cantharellus californicus

At a glance

Sources9 archives

At a glance

Record type1 489 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions3 of 4 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 489 records