Cantharellus appalachiensis

R.H.Petersen · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Cantharellales/Hydnaceae/Cantharellus

At a glance

Occurrence records538

Data sources10

Biological traits0

DNA specimens7

eDNA detections5

Sources10 archives

Databases and archives Cantharellus appalachiensis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility538 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF538 records

Environmental DNA1 datasets · 1 countries5 detections

DNA & barcodingBOLD · NCBI7 specimens

Genome at a glanceGoaT · NCBI≈131 Mbp

01Narrative

Cantharellus appalachiensis is a fungus native to eastern North America in the genus Cantharellus, which includes other popular edible chanterelles. The cap color varies from brown to yellow, often with a brown spot on the cap at maturity. C. appalachiensis is mycorrhizal and is found in hardwood forests. The scientific name C. appalachiensis is after the Appalachian Mountains.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cantharellus appalachiensis has left across the world's sequence archives.

At a glance

DNA specimens7

Marker genes3

GenBank sequences5

eDNA detections5

Countries2

The DNA barcodea real sequence read deposited for this species

ITSMH281862.1 ↗327 bpUSA · 2017

ACGT

AGGATCAACCCATGATGACGCATGCGTCTATCTTTTTTTCTTCGTGGACAAGTCTTCTCCCTCTGCGTCCATTGGACTGGGTGCTTTGTG …

Cantharellus appalachiensis voucher FLAS-F-61022 internal transcribed spacer 1, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★ITS5★ITS1

animal barcodefungal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Cantharellus appalachiensis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈131 127 230 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

THIS GENOME Cantharellus appalachiensis0.13 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

Completeness84.1% BUSCO

08Occurrence & distribution

Record type538 records

Wild obs. + sensor439

Museum / vouchered99

Range

Area of Occupancy AOO1 540 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy52% within 1 km

≤100 m 101≤1 km 39≤10 km 61>10 km 68

269 georeferenced · 170 without coordinates

Open the mapobservation + sensor439

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy37% within 1 km

≤100 m 3≤1 km 10≤10 km 17>10 km 5

35 georeferenced · 64 without coordinates

Open the institutions mapphysical evidence99

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Davis and Elkins Collegelocation not on record	32
TENN-Flocation not on record	26
Bronx, US	10
Chicago, US	10
Université de Montréal Biodiversity Centrelocation not on record	5
Purdue Universitylocation not on record	4
ILLSlocation not on record	4
FLASlocation not on record	3
Blacksburg, US	2
Bernard Price Institute for Palaeontological Researchlocation not on record	1

10 institutions · 97 of 99 vouchered records shown · 1 without an institution code

09Environmental DNA5 detections

Where the DNA of Cantharellus appalachiensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.1 °C 25.1–25.1

Seasonal swing summer↔winter16.5 °C

Max temp (day)30.5 °C

Min temp (night)19.3 °C

Precipitation109 mm/mo

Air humidity52.0 %

Moisture balance-17.8 mm/mo

Vapour deficit1,616 Pa

Wind speed1.80 m/s

Cloud cover25.2 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)