Cantharellus amethysteus

(Quél.) Sacc. · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Cantharellales/Hydnaceae/Cantharellus

At a glance

Occurrence records2 917

Data sources9

Biological traits0

DNA specimens6

eDNA detections3

Sources9 archives

Databases and archives Cantharellus amethysteus's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 917 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF2 917 records

Environmental DNA1 datasets · 2 countries3 detections

DNA & barcodingBOLD · NCBI6 specimens

01Narrative

Cantharellus amethysteus, the amethyst chanterelle, is a species of Cantharellus from Europe.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cantharellus amethysteus has left across the world's sequence archives.

At a glance

DNA specimens6

Marker genes1

GenBank sequences7

eDNA detections3

Countries3

The DNA barcodea real sequence read deposited for this species

ITSKR677512.1 ↗419 bpSpain · 2013

ACGT

GCACTTCTAATCTAACACCAAGCGAATCATCGAGTCTTTGAACGCAAACGGCACCCTTCCAGTCCATTCCAAAGCGGTGGCGGAGGATGA …

Cantharellus amethysteus clone AH44796 5.8S ribosomal RNA gene and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS7

fungal barcode

08Occurrence & distribution

Record type2 917 records

Wild obs. + sensor2 664

Museum / vouchered252

Other1

Range

Area of Occupancy AOO6 060 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy36% within 1 km

≤100 m 464≤1 km 196≤10 km 1 067>10 km 83

1 810 georeferenced · 854 without coordinates

Open the mapobservation + sensor2 664

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy83% within 1 km

≤100 m 87≤1 km 67≤10 km 29>10 km 2

185 georeferenced · 67 without coordinates

Open the institutions mapphysical evidence252

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 28 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Olocation not on record	82
San Sebastián, ES	20
University of the Basque Country (UPV/EHU)location not on record	16
Kew, GB	14
Copenhagen, DK	12
nsnflocation not on record	11
Bardejov, SK	8
Göteborg, SE	7
LDlocation not on record	7
SLU Artdatabankenlocation not on record	6
CJBGlocation not on record	6
GJOlocation not on record	5
Uppsala, SE	5
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	4
Philadelphia, US	4
Karlsruhe, DE	4
Universidade de Lisboa, Museu Bocagelocation not on record	3
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	2
Staten Island, US	2
Senckenberg Gesellschaft für Naturforschung: Senckenberg Forschungsinstitut und Naturmuseumlocation not on record	2
University of Oslo, Natural History Museumlocation not on record	2
Vitoria, ES	2
BRNUlocation not on record	1
Gijón, ES	1
WU-MYClocation not on record	1
Trondheim, NO	1
Zürich, CH	1
University of Warsawlocation not on record	1

28 institutions · 230 of 252 vouchered records shown · 21 without an institution code

09Environmental DNA3 detections

Where the DNA of Cantharellus amethysteus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.4 °C 7.20–12.8

Seasonal swing summer↔winter17.4 °C

Max temp (day)14.2 °C 10.6–15.2

Min temp (night)9.10 °C 2.70–9.80

Precipitation117 mm/mo 89.4–239

Air humidity64.2 % 62.0–65.5

Moisture balance62.7 mm/mo 35.6–162

Vapour deficit515 Pa 399–560

Wind speed2.60 m/s 1.90–5.30

Cloud cover43.4 % 43.3–47.1

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Cantharellus amethysteus

At a glance

Sources9 archives

At a glance

Record type2 917 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions13 of 28 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 917 records