Cantharellopsis prescotii

(Weinm.) Kuyper · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Hymenochaetales/Cantharellopsis

At a glance

Occurrence records430

Data sources8

Biological traits0

DNA specimens6

eDNA detections23

Sources8 archives

Databases and archives Cantharellopsis prescotii's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility430 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI23 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF430 records

Environmental DNA2 datasets · 5 countries23 detections

DNA & barcodingBOLD · NCBI6 specimens

01Narrative

Pępóweczka biaława – gatunek grzybów z rzędu szczeciniakowców (Hymenochaetales). Jest jedynym gatunkiem rodzaju Cantharellopsis.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cantharellopsis prescotii has left across the world's sequence archives.

At a glance

DNA specimens6

Marker genes1

GenBank sequences10

eDNA detections23

Countries5

The DNA barcodea real sequence read deposited for this species

ITSPQ013164.1 ↗518 bpSweden · 2022

ACGT

CATTATCGAGTCTTTGATGTGGGTTTGATGCTGGCCTCCCTCGGGGGGCATGTGCTCGCCCCGCTCAATCCACTCAACCCCTGTGCACCA …

Cantharellopsis prescotii voucher UPS:F-1128363 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10

fungal barcode

08Occurrence & distribution

Record type430 records

Wild obs. + sensor239

Museum / vouchered191

Range

Area of Occupancy AOO1 200 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 149≤1 km 44≤10 km 38>10 km 2

233 georeferenced · 6 without coordinates

Open the mapobservation + sensor239

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy69% within 1 km

≤100 m 42≤1 km 51≤10 km 30>10 km 11

134 georeferenced · 57 without coordinates

Open the institutions mapphysical evidence191

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions16 of 30 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Olocation not on record	35
Helsinki, FI	26
SLU Artdatabankenlocation not on record	12
Philadelphia, US	11
Göteborg, SE	11
TUR-Alocation not on record	11
Trondheim, NO	7
Uppsala, SE	6
WU-MYClocation not on record	5
Tartu, EE	3
Zürich, CH	3
Vancouver, CA	3
University of Oslo, Natural History Museumlocation not on record	3
Kuopio, FI	2
Rene Pomerleau Herbariumlocation not on record	2
Karlsruhe, DE	2
nsnflocation not on record	2
TROMlocation not on record	2
Stockholm, SE	1
Trondheim, NO	1
CJBGlocation not on record	1
Gijón, ES	1
TENN-Flocation not on record	1
Turku, FI	1
BioFokuslocation not on record	1
Tromso University Museumlocation not on record	1
WTUlocation not on record	1
CA	1
IB FRC Komi SC UB RASlocation not on record	1
Copenhagen, DK	1

30 institutions · 158 of 191 vouchered records shown · 33 without an institution code

09Environmental DNA23 detections

Where the DNA of Cantharellopsis prescotii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found23

Studies independent surveys2

Countries5

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 23 detections have coordinates

Open the map5 countries0

Mose, skifrig.Pessiere blanche

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.2 °C 5.00–16.9

Seasonal swing summer↔winter25.0 °C

Max temp (day)18.8 °C 7.30–19.5

Min temp (night)11.6 °C 2.70–14.1

Precipitation106 mm/mo 78.5–110

Air humidity60.8 % 57.1–65.2

Moisture balance-2.40 mm/mo -32.5–56.0

Vapour deficit743 Pa 328–754

Wind speed3.90 m/s 2.60–5.60

Cloud cover48.4 % 38.7–57.0

CHELSA 1981–2010, ~9 km grid, at location & month of 19 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)