Canna tuerckheimii

Kraenzl. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Zingiberales/Cannaceae/Canna

At a glance

Occurrence records281

Data sources10

Biological traits16

DNA specimens27

eDNA detections21

Sources10 archives

Databases and archives Canna tuerckheimii's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility281 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI21 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics27 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources16 traits

Occurrence & distributionGBIF281 records

Environmental DNA1 datasets · 1 countries21 detections

DNA & barcodingBOLD · NCBI27 specimens

Genome at a glanceCCDB2n = 18

01Narrative

Flowers Canna tuerckheimii is a species of the Canna genus, belonging to the family Cannaceae. Its specific epithet tuerckheimii commemorates Hans von Türckheim, a 19th-century German plant collector.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology1

Plant height4 m

Life cycle & reproduction3

Life formrhizomatous geophyte

Life spanperennial

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Elevation max2 000 m

Elevation mean730 m

Elevation min300 m

Epiphyteterrestrial

Growth formherb

Habitat GIFTforest

Woodinessnon-woody

Physiology & chemistry1

Nitrogen fixingnon_nitrogen_fixer

05DNA & barcoding27 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Canna tuerckheimii has left across the world's sequence archives.

At a glance

DNA specimens27

Marker genes4

GenBank sequences10

eDNA detections21

Countries2

The DNA barcodea real sequence read deposited for this species

rbcLJX978618.1 ↗300 bpCosta Rica · 2010

ACGT

AAGAAGCAGGGGCTGCGGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACTGATGGACTTACCAGTCTTGATCGTTACA …

Canna tuerckheimii isolate 95948828 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL8★rbcLa★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Canna tuerckheimii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 181×CCDB · book-ipcn67-71

CCDB · book-ipcn67-71 — SEGEREN, w.' & P.J.M. MAAS. 1971. The genus Canna in northern South America. Acta Bot. Neer. 20: 663-680.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type281 records

Wild obs. + sensor61

Museum / vouchered219

Other1

Range

Area of Occupancy AOO712 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy75% within 1 km

≤100 m 22≤1 km 8≤10 km 4>10 km 6

40 georeferenced · 21 without coordinates

Open the mapobservation + sensor61

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy80% within 1 km

≤100 m 7≤1 km 1≤10 km 2

10 georeferenced · 209 without coordinates

Open the institutions mapphysical evidence219

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 25 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Saint Louis, US	96
National Biodiversity Institute, Costa Ricalocation not on record	24
Museo Nacional de Costa Rica (MNCR)location not on record	19
Mexico City, MX	11
Area de Conservacion Guanacastelocation not on record	4
León, NI	4
Edinburgh, GB	3
Antiguo Cuscatlán, SV	3
Chicago, US	3
Durham, US	3
University of Stellenboschlocation not on record	3
Teresina, BR	2
Xiamen, CN	2
CASlocation not on record	2
MAlocation not on record	1
Kew, GB	1
Cambridge, US	1
Ulocation not on record	1
QCNElocation not on record	1
Universidad Nacional Agrarialocation not on record	1
San José, CR	1
Sangmiung Universitylocation not on record	1
Aarhus, DK	1
COLlocation not on record	1
South Kensington, GB	1

25 institutions · 190 of 219 vouchered records shown · 28 without an institution code

09Environmental DNA21 detections

Where the DNA of Canna tuerckheimii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found21

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 21 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.4 °C 22.5–24.4

Seasonal swing summer↔winter2.30 °C

Max temp (day)28.2 °C 26.4–28.2

Min temp (night)21.1 °C 19.2–21.1

Precipitation58.6 mm/mo 58.6–156

Air humidity65.5 % 65.5–68.3

Moisture balance-102 mm/mo -102–11.8

Vapour deficit1,051 Pa 875–1,051

Wind speed2.00 m/s 1.90–2.00

Cloud cover13.6 % 13.6–22.5

CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)