Canna liliiflora — The Life Data

Plantae/Tracheophyta/Liliopsida/Zingiberales/Cannaceae/Canna

At a glance

Occurrence records14

Data sources8

Biological traits9

DNA specimens15

eDNA detections15

Sources8 archives

Databases and archives Canna liliiflora's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility14 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI15 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics15 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources9 traits

Occurrence & distributionGBIF14 records

Environmental DNA1 datasets · 0 countries15 detections

DNA & barcodingBOLD · NCBI15 specimens

01Narrative

Canna liliiflora is a species of herb in the family Cannaceae. It is native of Peru and Bolivia.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formrhizomatous geophyte

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding15 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Canna liliiflora has left across the world's sequence archives.

At a glance

DNA specimens15

Marker genes2

GenBank sequences10

eDNA detections15

The DNA barcodea real sequence read deposited for this species

ITSFJ939554.1 ↗664 bp

ACGT

TTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTCCACAACGAGGACGACCGCGAACACGTAAACGATGCTCGTCGTCGCATG …

Canna liliiflora voucher Refulio 227 (RSA) clone 2 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS10ITS2

fungal barcode

08Occurrence & distribution

Record type14 records

Museum / vouchered14

Range

Area of Occupancy AOO24 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 14 records without

Open the institutions mapphysical evidence14

10Collections & institutions

Holding institutions5 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Saint Louis, US	4
Kew, GB	2
Bronx, US	1
University of Stellenboschlocation not on record	1
Cochabamba, BO	1
La Paz, BO	1

6 institutions · 10 of 14 vouchered records shown · 4 without an institution code

09Environmental DNA15 detections

Where the DNA of Canna liliiflora was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found15

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 15 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.