Canna iridiflora

Ruiz & Pav. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Zingiberales/Cannaceae/Canna

At a glance

Occurrence records47

Data sources9

Biological traits9

DNA specimens6

eDNA detections6

Sources9 archives

Databases and archives Canna iridiflora's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility47 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources9 traits

Occurrence & distributionGBIF47 records

Environmental DNA1 datasets · 0 countries6 detections

DNA & barcodingBOLD · NCBI6 specimens

Genome at a glanceCCDB2n = 18

01Narrative

اختر تیراژهگل نام یک گونه از سرده اختر است.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Life cycle & reproduction2

Life formrhizomatous geophyte

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Canna iridiflora has left across the world's sequence archives.

At a glance

DNA specimens6

Marker genes3

GenBank sequences7

eDNA detections6

The DNA barcodea real sequence read deposited for this species

ITSFJ939489.1 ↗682 bp

ACGT

TTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTCCACAACGAGGACGACCGTGAACGCGTAAACGATACTCGTCGTCGCATG …

Canna iridiflora voucher Plowman & Davis 4753 (US) clone 4 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL2★ITS5★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Canna iridiflora carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 181×CCDB · book-ipcn67-71

CCDB · book-ipcn67-71 — SEGEREN, w.' & P.J.M. MAAS. 1971. The genus Canna in northern South America. Acta Bot. Neer. 20: 663-680.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type47 records

Wild obs. + sensor5

Museum / vouchered42

Range

Area of Occupancy AOO80 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy80% within 1 km

≤100 m 4≤10 km 1

5 georeferenced

Open the mapobservation + sensor5

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 2

2 georeferenced · 40 without coordinates

Open the institutions mapphysical evidence42

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Auckland, NZ	7
Saint Louis, US	6
Universiti Sains Malaysialocation not on record	3
Chicago, US	3
National Biodiversity Institute, Costa Ricalocation not on record	3
HUT Culture Collectionlocation not on record	2
South Kensington, GB	2
Cusco, PE	1
Kew, GB	1
Museo Nacional de Costa Rica (MNCR)location not on record	1
Lima, PE	1
Iquitos, PE	1
San José, CR	1

13 institutions · 32 of 42 vouchered records shown · 10 without an institution code

09Environmental DNA6 detections

Where the DNA of Canna iridiflora was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)