Canna indica
speciesAt a glance
Occurrence records13 507
Data sources15
Biological traits66
DNA specimens63
eDNA detections52
Sources15 archives
Databases and archives Canna indica's data was compiled from.
WikipediaWikimedia Foundation14 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility13 479 records↗
OBISOcean Biodiversity Information System28 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI52 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics63 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
giftgenome & karyotype
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources66 traits
Chemical compositionLOTUS7 compounds
Occurrence & distributionGBIF · OBIS13 507 records
Environmental DNA1 datasets · 5 countries52 detections
DNA & barcodingBOLD · NCBI63 specimens
Genome at a glanceCCDB · GIFT · GoaT787 Mbp
01Narrative
Canna compacta Roscoe is a species of the Canna genus, belonging to the family Cannaceae, distributed between the south of Brazil and northern Argentina. Introduced to England from South America in 1820.Johnson's Gardeners Dictionary, 1856 Not to be confused with C. compacta Bouché, which is a synonym of C. indica L.Tanaka, N. 2001. Taxonomic revision of the family Cannaceae in the New World and Asia. Makinoa ser. 2, 1:34–43. It is a perennial growing to 2m. It is hardy to zone 10 and is frost tender. In the north latitudes it is in flower from August to October, and the seeds ripen in October. The flowers are hermaphrodite, and are widely grown in horticulture.Cooke, Ian, 2001. The Gardener's Guide to Growing cannas, Timber Press.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPGIFTAusTraitsTRY
Size & morphology24
Fruit length25 mm
⚠ sources differ — AusTraits: 25 mm · GIFT: 17.5 mm
Fruit length max30 mm
Fruit length min12 mm
Fruit width15 mm
Leaf length450 mm
⚠ sources differ — AusTraits: 450 mm · GIFT: 200 mm
Leaf length max600 mm
Leaf length min30 mm
Leaf width250 mm
⚠ sources differ — AusTraits: 250 mm · GIFT: 150 mm
Leaf width max450 mm
Leaf width min10 mm
Plant height1.8 m
⚠ sources differ — GIFT: 1.8 m · AusTraits: 2 m · TRY: 1.32 m
Plant height max2 m
Plant height min0.8 m
Seed length5.5 mm
Seed length max7 mm
Seed length min3 mm
Seed mass176 mg
⚠ sources differ — TRY: 176 mg · GIFT: 190 mg
Seed mass max250 mg
Seed mass min120 mg
Seed volume210 mm³
Seed volume max210 mm³
Seed volume min210 mm³
Seed width max7 mm
Seed width min3 mm
Life cycle & reproduction18
Deciduousnessevergreen
Dehiscencedehiscent
Dispersal typeunspecialized
Flower colouryellow
Flower length max18 mm
Flower length min10 mm
Flowering endJul
Flowering startApr
Flowering timeyynnnnnnyyyy
Life formrhizomatous geophyte
Life spanperennial
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formcryptophyte
Reproduction asexualpresent
Resprouting capacityresprouts
Self fertilizationabsent
Sex typehermaphrodite
Diet & foraging1
Parasiteindependent
Habitat & environment16
Aquaticterrestrial
Climateseasonally dry tropical
Climberself-supporting
Elevation max2 620 m
Elevation mean1 800 m
Elevation min0 m
Epiphyteterrestrial
Fruit fleshinessdry
Fruit typecapsule
Growth formherb
Habitat GIFTÁrea Antrópica, Campo de Várzea, Cerrado (lato sensu), Floresta Estacional Semidecidual, Floresta Ombrófila (= Floresta Pluvial), Restinga, Savana Amazônica
Leaf compoundnesssimple
Leaf shapeelliptical
Mycorrhiza type0.0000000437
Succulenceno
Woodinessnon-woody
Physiology & chemistry5
Leaf n39.7 mg/g
Leaf p2.5 mg/g
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
Specific leaf area (SLA)22.61 mm²/mg
Other traits2
Seeds per fruit11-100
Shoot orientationerect
03Chemical composition7 compounds
Compounds documented for Canna indica across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
🍽 Used in cooking
Compound class profile2 classes
Cinnamic acids and derivatives6
Neolignans1
Documented compounds7 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (2R)-2-{[(2E)-3-[(2R,3R)-3-{[(1R)-1-Carboxy-2-(3,4-dihydroxyphenyl)ethoxy]carbonyl}-2-(3,4-dihydroxyphenyl)-7-hydroxy-2,3-dihydro-1-benzofuran-4-YL]prop-2-enoyl]oxy}-3-(3,4-dihydroxyphenyl)propanoic acid | present | LOTUS | |
| (S)-Rosmarinic acid | present | LOTUS | |
| 3-(3,4-Dihydroxyphenyl)Prop-2-Enoic Acid | present | LOTUS | |
| [(2R,3R,4S,5S)-5-[(2R,3R,4S,5S,6R)-6-(acetyloxymethyl)-3,4,5-trihydroxyoxan-2-yl]oxy-3-hydroxy-5-(hydroxymethyl)-4-[(E)-3-(4-hydroxyphenyl)prop-2-enoyl]oxyoxolan-2-yl]methyl (E)-3-(4-hydroxyphenyl)prop-2-enoate | present | LOTUS | |
| [(2S,3S,4R,5R)-2-[(2R,3R,4S,5S,6R)-6-(acetyloxymethyl)-3,4,5-trihydroxyoxan-2-yl]oxy-4-hydroxy-5-[[(E)-3-(4-hydroxy-3-methoxyphenyl)prop-2-enoyl]oxymethyl]-2-(hydroxymethyl)oxolan-3-yl] (E)-3-(4-hydroxyphenyl)prop-2-enoate | present | LOTUS | |
| coumaroyl(-6)Fruf(b2-1a)Glc | present | LOTUS | |
| trans-Caffeic acid | present | LOTUS |
05DNA & barcoding63 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Canna indica has left across the world's sequence archives.
At a glance
DNA specimens63
Marker genes7
GenBank sequences10
eDNA detections52
Countries6
The DNA barcodea real sequence read deposited for this species
TGTACTTGAGTCTTTGACGCAGTTGTGCCCGAGGCCTTGTGGTCGAGGGCACGCCTGCTTGGGTGTCATGACATCGTCGCTTTTGCTCCA …
Canna indica isolate Ca8 5.8S ribosomal RNA gene and internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★COI-5P★matK2★rbcL7★rbcLa★ITS1★ITS2trnH-psbA
animal barcodeplant barcodefungal barcodemarker
06Genome at a glanceCCDB · GIFT · GoaT · NCBI
The complete instruction manual Canna indica carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size786 890 815 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Canna indica0.79 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 18 n = 9
Ploidy2× / 3× cytotypes
Chromosome records18–182n range18median18mode45records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 1845×GoaT · Kew Plant DNA C-values Database · CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 +7
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · ipcn-api-dl — Hanson, L., K. A. McMahon, M. A. T. Johnson & M. D. Bennett. 2001. First nuclear DNA C-values for another 25 angiosperm families. Ann. Bot. (Oxford) 88: 851–858.
CCDB · book-ipcn67-71 — MAHANTY, H.K. 1970. A cytological study of the Zingiberales with special reference to their taxonomy. Cytologia 35: 13-49.
CCDB · book-ipcn67-71 — SEGEREN, w.' & P.J.M. MAAS. 1971. The genus Canna in northern South America. Acta Bot. Neer. 20: 663-680.
CCDB · book-ipcn67-71 — KHOSHOO, T.N., & I. MUKHERJEE. 1970. Genetic-evolutionary studies on cultivated Cannas. III. Variation in meiotic system. Cellule. 68: 109-134.
CCDB · book-ipcn67-71 — BISSON, s. ,s. GUILLEMET, & J. - L. HAMEL. 1968. Contribution a l'etude caryo-taxinomique des Scitaminees Mem. Mus. National Hist. Naturelle Ser. B. 18: 59-133.
CCDB · book-indian_vol2 — Belling (Tischler, G. 1931); Sim- monds, N.W. 1954 ; Sa to, D. 1960; Khoshoo, T.N. ,& Mukherjee, I. 1970
CCDB · book-indian_vol2 — Kuwada (Tischler, G. 1927a) ; Belling, J. 1921 ; Heitz, E. 1926 ; Honing, J.A. 1928 ; Delay, C. 1947 ; Sato, D. 1948, 1960; Bisson, S. eta!. . 1968 ; Khoshoo, T.N. & Mukherjee, I. 1970; Segeren, W. & Mass, P.J.M. 1971 ; Khoshoo, T.N. 1979
CCDB · eflora
CCDB · book-fedorov — Offerijns 1936
CCDB · book-fedorov — Belling (T. 1931)
CCDB · book-fedorov — Simmonds 1954
CCDB · book-fedorov — Sato D. 1960
CCDB · book-fedorov — Kuwada (T. 1927)
CCDB · book-fedorov — Belling 1921
CCDB · book-fedorov — Heitz 1926
CCDB · book-fedorov — Honing 1928
CCDB · book-fedorov — Delay 1947
CCDB · book-fedorov — SatO D. 1948, 1960
CCDB · book-atlas-flowering-plants — Offerijns 1935
CCDB · book-atlas-flowering-plants — Simmonds 1954
CCDB · book-atlas-flowering-plants — Honing 1928
CCDB · kew — Hanson L., McMahon KA, Johnson MAT, Bennett MD. 2001. First nuclear DNA C-values for another 25 angiosperm families. Annals of Botany 88: 851-858
CCDB · Automatic manuscript search — N. Tanaka,H. Uchiyama,H. Matoba and T. Koyama. 2009. "Karyological analysis of the genus Canna (Cannaceae)". Plant Systematics and Evolution 280:45-51.
GIFT · GIFT (floras)
2n 277×GoaT · Kew Plant DNA C-values Database · CCDB · book-indian_vol2 · CCDB · book-fedorov +1
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · book-indian_vol2 — Venkatasubban, K.R. 1946
CCDB · book-indian_vol2 — Belling, J. 1925
CCDB · book-fedorov — Venkatasubban 1946
CCDB · book-fedorov — Belling 1925b
CCDB · book-atlas-flowering-plants — Venkatasubban 1946
CCDB · book-atlas-flowering-plants — Belling 1925
n 96×CCDB · book-ipcn67-71 · CCDB · iapt
CCDB · book-ipcn67-71 — KHOSHOO, T.N., & I. MUKHERJEE. 1970. Genetic-evolutionary studies on cultivated Cannas. III. Variation in meiotic system. Cellule. 68: 109-134.
CCDB · iapt — IAPT/IOPB Chromosome Data 18
n 181×CCDB · iapt
CCDB · iapt — IAPT/IOPB Chromosome Data 28
n 271×GIFT · GIFT (floras)
GIFT · GIFT (floras)
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GIFT · GIFT (floras)
GIFT · GIFT (floras)
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
Sequencing statusassembly quality — how far to trust these numbers
Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.
Assembly levelComplete Genome
08Occurrence & distribution
Record type13 507 records
Wild obs. + sensor9 794
Museum / vouchered3 488
Cultivated / captive32
Other193
Origin
Native358
Introduced744
Range
Area of Occupancy AOO30 640 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy80% within 1 km
≤100 m 4 484≤1 km 1 917≤10 km 1 233>10 km 324
7 958 georeferenced · 1 836 without coordinates
Open the mapobservation + sensor9 794
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy84% within 1 km
≤100 m 757≤1 km 93≤10 km 140>10 km 16
1 006 georeferenced · 2 482 without coordinates
Open the institutions mapphysical evidence3 488
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy29% within 1 km
≤1 km 2≤10 km 5
7 georeferenced · 25 without coordinates
Open the mapnot free-living32
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions144 of 318 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Durango, MX | 501 |
| Saint Louis, US | 280 |
| Mexico City, MX | 135 |
| Bronx, US | 88 |
| MeiseBGlocation not on record | 75 |
| Guangzhou, CN | 73 |
| Blumenau, BR | 65 |
| Chapingo, MX | 52 |
| Durban, ZA | 46 |
| UTFPR-CPlocation not on record | 45 |
| University of Stellenboschlocation not on record | 45 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 39 |
| Kunming, CN | 38 |
| Mérida, MX | 37 |
| Campo Mourão, BR | 36 |
| Auckland, NZ | 34 |
| Brisbane, AU | 32 |
| Instituto Amazónico de Investigaciones Científicas - SINCHIlocation not on record | 30 |
| Kew, GB | 30 |
| San Isidro, AR | 29 |
| Tuxtla Gutiérrez, MX | 29 |
| Puerto Ayora, EC | 28 |
| Pretoria, ZA | 28 |
| Mount Annan, AU | 28 |
| Chaguaramas, TT | 25 |
| Museo Entomologico de Leonlocation not on record | 25 |
| Mexico City, MX | 22 |
| Ciudad de México, MX | 21 |
| Xiamen, CN | 20 |
| Córdoba, AR | 20 |
| INMAlocation not on record | 20 |
| National Biodiversity Institute, Costa Ricalocation not on record | 19 |
| Yaoundé, CM | 19 |
| Centro de Investigación en Biodiversidad y Conservación, Universidad Autónoma del Estado de Moreloslocation not on record | 18 |
| Honolulu, US | 17 |
| Santa Teresa, BR | 17 |
| Austin, US | 17 |
| BISHlocation not on record | 16 |
| Jena Microbial Resource Collectionlocation not on record | 16 |
| Salvador, BR | 16 |
| Laboratorio de Ictiologialocation not on record | 16 |
| Chengdu, CN | 15 |
| Riverside, US | 15 |
| Tapachula, MX | 15 |
| Leiden University Medical Centerlocation not on record | 15 |
| Antiguo Cuscatlán, SV | 15 |
| Guilin, CN | 15 |
| Canberra, AU | 14 |
| Centro de Estudios y Colecciones Biológicas para la Conservaciónlocation not on record | 14 |
| MAlocation not on record | 14 |
| Berlin, DE | 14 |
| Christchurch, NZ | 14 |
| Ciudad de México, MX | 13 |
| León, NI | 13 |
| Universidad Nacional de Colombia (UNAL)location not on record | 13 |
| Universidad de Caldas (UCaldas)location not on record | 13 |
| JBRJlocation not on record | 12 |
| Autlán de Navarro, MX | 12 |
| Taipei, TW | 12 |
| Université de Bordeauxlocation not on record | 12 |
| Paleontological Collectionlocation not on record | 12 |
| BIO-UNIPIlocation not on record | 12 |
| Universidad Juárez Autónoma de Tabascolocation not on record | 11 |
| Wellington, NZ | 11 |
| St. Augustine, TT | 11 |
| UFBAlocation not on record | 11 |
| National Herbarium & Botanic Gardens of Malawilocation not on record | 11 |
| San Francisco de Campeche, MX | 10 |
| Tuxtla Gutiérrez, MX | 10 |
| Adam Mickiewicz University in Poznańlocation not on record | 10 |
| HAWlocation not on record | 10 |
| Feira de Santana, BR | 9 |
| Kochi, JP | 9 |
| UFESlocation not on record | 9 |
| Mexico City, MX | 9 |
| Chicago, US | 9 |
| Museo naturalistico del Frignano Ferruccio Minghellilocation not on record | 9 |
| Tlalnepantla, MX | 9 |
| PUC-RSlocation not on record | 8 |
| UFSClocation not on record | 8 |
| Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record | 8 |
| Altos de Pipe, VE | 8 |
| Puebla, MX | 8 |
| WAGlocation not on record | 8 |
| Aarhus, DK | 8 |
| Armidale, AU | 8 |
| QCNElocation not on record | 8 |
| Istituto Agrario Castelnuovolocation not on record | 8 |
| Universidade de Passo Fundolocation not on record | 8 |
| Pontifícia Universidade Católica do Paranálocation not on record | 7 |
| Universidad de La Salle (La Salle)location not on record | 7 |
| South Kensington, GB | 7 |
| Beijing, CN | 7 |
| MEXUlocation not on record | 7 |
| Universidade Federal de Santa Catarinalocation not on record | 7 |
| Institut fur Allgemeine Mikrobiologielocation not on record | 6 |
| CEPLAClocation not on record | 6 |
| Herbier National du Gabonlocation not on record | 6 |
| Foz do Iguaçu, BR | 6 |
| Federal University of Espírito Santolocation not on record | 6 |
| Masindi, UG | 6 |
| UFPRlocation not on record | 6 |
| UTFPR-DVlocation not on record | 6 |
| LBVlocation not on record | 6 |
| Ann Arbor, US | 6 |
| UFRPElocation not on record | 5 |
| Smithfield, AU | 5 |
| Guangzhou, CN | 5 |
| HNBlocation not on record | 5 |
| Uppsala, SE | 5 |
| UNIVASFlocation not on record | 5 |
| Instituto de Investigaciones Biológicas, Universidad Veracruzana, Región Xalapalocation not on record | 5 |
| Tampa, US | 5 |
| EL PASO, US | 4 |
| CNF-UFHBlocation not on record | 4 |
| Santa Cruz de la Sierra, BO | 4 |
| UNICAMPlocation not on record | 4 |
| Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record | 4 |
| Departamento de Geologia, Universidad de Chilelocation not on record | 4 |
| Plocation not on record | 4 |
| Dresden, DE | 4 |
| FUVATESlocation not on record | 4 |
| Cape Town, ZA | 4 |
| Universidade Federal de Sergipe (UFS)location not on record | 4 |
| Universidad Católica de Oriente (UCO)location not on record | 4 |
| Nagasaki University - Fisherieslocation not on record | 4 |
| Cruz das Almas, BR | 4 |
| Seoul, KR | 4 |
| Moscow State Universitylocation not on record | 4 |
| Baroda, IN | 4 |
| FUNEDlocation not on record | 4 |
| Museu Nacional, Universidade Federal do Rio de Janeirolocation not on record | 4 |
| BDBClocation not on record | 4 |
| IPA/SPlocation not on record | 4 |
| València, ES | 4 |
| UFMSlocation not on record | 4 |
| John T. Waterhouse Herbariumlocation not on record | 4 |
| Vancouver, CA | 3 |
| UESBlocation not on record | 3 |
| Mérida, MX | 3 |
| Millersville, US | 3 |
| Universidad Distrital Francisco José de Caldas (UDistrital)location not on record | 3 |
| HUENFlocation not on record | 3 |
| Universidade Tecnológica Federal do Paranálocation not on record | 3 |
| Université de Strasbourglocation not on record | 3 |
| Cochabamba, BO | 3 |
| Pontifícia Universidade Católica do Paranálocation not on record | 3 |
| Rotorua, NZ | 3 |
| Provincia di Livornolocation not on record | 3 |
| Guatemala City, GT | 3 |
| Cascavel, BR | 3 |
| Université du Lomélocation not on record | 3 |
| UNESClocation not on record | 3 |
| Universidade Federal do Vale do São Franciscolocation not on record | 3 |
| Miami, US | 3 |
| TAFORI-LSRClocation not on record | 3 |
| Pondicherry, IN | 3 |
| Loja, EC | 3 |
| Changsha, CN | 3 |
| Criciúma, BR | 3 |
| Toyama, JP | 3 |
| CICYTEXlocation not on record | 3 |
| Yangling, CN | 3 |
| Bando, JP | 3 |
| Chicago, US | 3 |
| Area de Conservacion Guanacastelocation not on record | 3 |
| Badajoz, ES | 3 |
| Hazara Universitylocation not on record | 3 |
| Uniwersytet Śląski w Katowicachlocation not on record | 3 |
| UEMlocation not on record | 3 |
| Corporación Autónoma Regional Para la Defensa de la Meseta de Bucaramanga (CDMB)location not on record | 3 |
| Ivano-Frankivsk, UA | 2 |
| Londrina, BR | 2 |
| Centre National de la Recherche Scientifique et Technologique / Institut de l'environnement et de recherches agricoleslocation not on record | 2 |
| Wuhan, CN | 2 |
| College of the Atlantic, Museumlocation not on record | 2 |
| UFRRJlocation not on record | 2 |
| Austin, US | 2 |
| Barcelona, ES | 2 |
| ESALQlocation not on record | 2 |
| Jardín Botánico de Cartagena "Guillermo Piñeres" (JBC)location not on record | 2 |
| Universidad Nacional Agrarialocation not on record | 2 |
| Stellenbosch University, DST- NRF Centre of Excellence for Invasion Biologylocation not on record | 2 |
| Nanchong, CN | 2 |
| Pontificia Universidad Javeriana (PUJ)location not on record | 2 |
| UEMAlocation not on record | 2 |
| UTFPR-SLlocation not on record | 2 |
| Universidade Federal do Rio Grande do Nortelocation not on record | 2 |
| Tsukuba, JP | 2 |
| LfUlocation not on record | 2 |
| Kensington, AU | 2 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 2 |
| San Diego, US | 2 |
| Ischia Marine Centrelocation not on record | 2 |
| CJBGlocation not on record | 2 |
| UFPElocation not on record | 2 |
| Zhejiang Museum of Natural Historylocation not on record | 2 |
| IPHAMETRAlocation not on record | 2 |
| Departamento de Sistematica e Ecologialocation not on record | 2 |
| Brussels, BE | 2 |
| South China Normal Universitylocation not on record | 2 |
| Adelaide, AU | 2 |
| Nishihara, JP | 2 |
| HUAlocation not on record | 2 |
| Taipei, TW | 2 |
| Canadian Department of Agriculturelocation not on record | 2 |
| Universidad de la Amazonia (UniAmazonia)location not on record | 2 |
| Managua, NI | 2 |
| Uberlândia, BR | 2 |
| Parc Botanique et Zoologique de Tsimbazaza (PBZT)location not on record | 2 |
| Quito, EC | 2 |
| HQUlocation not on record | 2 |
| Empresa Pernambucana de Pesquisa Agropecuária, IPAlocation not on record | 2 |
| Madison, US | 2 |
| Sangmiung Universitylocation not on record | 2 |
| Wlocation not on record | 2 |
| Stockholm, SE | 2 |
| Dehra Dun, IN | 2 |
| Sucre, BO | 2 |
| Taipei, TW | 2 |
| BMlocation not on record | 2 |
| Philadelphia, US | 2 |
| Fort Worth, US | 2 |
| Maringá, BR | 2 |
| URCAlocation not on record | 2 |
| Pelotas, BR | 2 |
| UNEMATlocation not on record | 2 |
| Universidad Tecnológica del Chocó (UTCH)location not on record | 2 |
| Universidade Federal do Ceara, Departamento de Biologialocation not on record | 2 |
| Linares, MX | 2 |
| Kagoshima, JP | 2 |
| San José, CR | 1 |
| Gump Stationlocation not on record | 1 |
| Giardini Botanici Hanburylocation not on record | 1 |
| Riobamba, EC | 1 |
| Calabar, NG | 1 |
| La Paz, BO | 1 |
| Forestry Research Institute of Nigerialocation not on record | 1 |
| Glocation not on record | 1 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 1 |
| Corrientes, AR | 1 |
| Universidad Nacional de Asunciónlocation not on record | 1 |
| Montréal, CA | 1 |
| arosemena tola, EC | 1 |
| Universidade de São Paulolocation not on record | 1 |
| Bern, CH | 1 |
| Fortaleza, BR | 1 |
| Juriquilla, MX | 1 |
| Museo de Historia Natural de El Salvadorlocation not on record | 1 |
| ILLSlocation not on record | 1 |
| Wuzhou, CN | 1 |
| Boise, US | 1 |
| University of Hamburglocation not on record | 1 |
| DSMlocation not on record | 1 |
| UFMGlocation not on record | 1 |
| Ulocation not on record | 1 |
| Entomological Society of Latvialocation not on record | 1 |
| DBF-NHMDlocation not on record | 1 |
| UNESP, Campus São José Rio Prêtolocation not on record | 1 |
| Nishihara, JP | 1 |
| Universidade Federal do Espírito Santolocation not on record | 1 |
| ESP003location not on record | 1 |
| Instituto para la Investigación y la Preservación del Patrimonio Cultural y Natural del Valle del Cauca - INCIVAlocation not on record | 1 |
| Museu Paraense Emílio Goeldilocation not on record | 1 |
| UTPLlocation not on record | 1 |
| Podgorica, ME | 1 |
| Toluca, MX | 1 |
| GB | 1 |
| Jardín Botánico José Celestino Mutis (JBBJCM)location not on record | 1 |
| LISClocation not on record | 1 |
| Clocation not on record | 1 |
| Centro Cultural Santo Domingolocation not on record | 1 |
| Chengdu, CN | 1 |
| Universiti Sains Malaysialocation not on record | 1 |
| Universidad Autónoma de Nayaritlocation not on record | 1 |
| Chiba, JP | 1 |
| Universidad de Antioquia (UdeA)location not on record | 1 |
| Shanghai, CN | 1 |
| Sociedad para el Estudio de los Recursos Bióticos de Oaxaca, A. C.location not on record | 1 |
| Jaén, ES | 1 |
| Smithsonian Institution, National Museum of Natural Historylocation not on record | 1 |
| Gujarat Biodiversity Gene Banklocation not on record | 1 |
| Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record | 1 |
| Olocation not on record | 1 |
| NSW Dept of Planning, Industry and Environmentlocation not on record | 1 |
| Brasília, BR | 1 |
| Universidade da Região de Joinville - Univillelocation not on record | 1 |
| Angwin, US | 1 |
| UIBlocation not on record | 1 |
| Centre Suisse de Recherches Scientifiques en Côte d’Ivoirelocation not on record | 1 |
| Instituto Nacional de Pesquisas da Amazônia (INPA)location not on record | 1 |
| Toronto, CA | 1 |
| ASUlocation not on record | 1 |
| UNESP-IBILCElocation not on record | 1 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 1 |
| Herbario MAT de la Universidad Politécnica Estatal del Carchilocation not on record | 1 |
| Guasave, MX | 1 |
| HEMlocation not on record | 1 |
| UDESC-CAVlocation not on record | 1 |
| Hobart, AU | 1 |
| University of Johannesburglocation not on record | 1 |
| Universidade Federale do Rio Grande do Sullocation not on record | 1 |
| MSB-2797location not on record | 1 |
| Universidade Federal do Maranhãolocation not on record | 1 |
| Palmerston, AU | 1 |
| UnBlocation not on record | 1 |
| OTSlocation not on record | 1 |
| CASlocation not on record | 1 |
| Instituto de Ecología Aplicada, Universidad Autónoma de Tamaulipaslocation not on record | 1 |
| UFERSAlocation not on record | 1 |
| Catalina Island Conservancylocation not on record | 1 |
| Muzaffarabad, PK | 1 |
| HUFDlocation not on record | 1 |
| Peking Universitylocation not on record | 1 |
| UNIVILLElocation not on record | 1 |
| Paris, FR | 1 |
| Batemans Bay, AU | 1 |
| Station d'Ecologie de Lamtolocation not on record | 1 |
318 institutions · 3 224 of 3 488 vouchered records shown · 233 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA52 detections
Where the DNA of Canna indica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found52
Studies independent surveys1
Countries5
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 52 detections have coordinates
Open the map5 countries0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median21.7 °C 15.4–26.7
Seasonal swing summer↔winter11.1 °C
Max temp (day)26.3 °C 20.5–29.7
Min temp (night)15.9 °C 9.90–22.6
Precipitation122 mm/mo 53.8–336
Air humidity59.3 % 54.2–69.0
Moisture balance-28.0 mm/mo -52.6–181
Vapour deficit943 Pa 804–1,254
Wind speed2.90 m/s 2.20–3.80
Cloud cover38.7 % 14.0–41.2
CHELSA 1981–2010, ~9 km grid, at location & month of 12 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.