Candelina submexicana — The Life Data

Fungi/Ascomycota/Candelariomycetes/Candelariales/Candelariaceae/Candelina

At a glance

Occurrence records556

Data sources7

Biological traits1

DNA specimens2

eDNA detections2

Sources7 archives

Databases and archives Candelina submexicana's data was compiled from.

GBIFGlobal Biodiversity Information Facility556 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF556 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceGoaT · NCBI≈24 Mbp

02Traits & measurements

SourcesTRY

Habitat & environment1

Growth formlichen

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Candelina submexicana has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes1

GenBank sequences3

eDNA detections2

Countries2

The DNA barcodea real sequence read deposited for this species

ITSEF535216.1 ↗477 bpUSA

ACGT

AAGAGTAAGGGTCCTATGGGCCCGACCTCCCAACCCTTTGTATATTTACCATTGTTGCTTTGGCGGGCCCGCTTGGGGAGACCCACCGCT …

Candelina submexicana strain ARZ200 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS3

fungal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Candelina submexicana carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈23 786 893 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

THIS GENOME Candelina submexicana0.02 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

08Occurrence & distribution

Record type556 records

Wild obs. + sensor66

Museum / vouchered490

Range

Area of Occupancy AOO1 364 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 32≤1 km 4≤10 km 5

41 georeferenced · 25 without coordinates

Open the mapobservation + sensor66

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy43% within 1 km

≤100 m 8≤1 km 12≤10 km 22>10 km 4

46 georeferenced · 444 without coordinates

Open the institutions mapphysical evidence490

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions25 of 37 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
ASUlocation not on record	225
St. Paul, US	69
LDlocation not on record	59
EL PASO, US	13
Madison, US	12
DOI/NPS, Colonial National Historical Parklocation not on record	10
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	7
Stockholm, SE	6
Chicago, US	6
Olocation not on record	6
Wuzhou, CN	5
Santa Barbara, US	5
Zapopan, MX	5
Durham, US	5
MeiseBGlocation not on record	4
McWane Science Centerlocation not on record	4
University of Stellenboschlocation not on record	4
Anchorage, US	4
Albuquerque, US	3
Bergen, NO	3
US	3
Berlin, DE	3
Mexico City, MX	3
Bronx, US	2
PHlocation not on record	2
Logan, US	2
Arequipa, PE	2
Boise, US	2
Uppsala, SE	2
CASlocation not on record	1
Fort Worth, US	1
US	1
Toronto, CA	1
Universidad Nacional de Colombia (UNAL)location not on record	1
ILLSlocation not on record	1
Helsinki, FI	1
Orem, US	1

37 institutions · 484 of 490 vouchered records shown · 5 without an institution code

09Environmental DNA2 detections

Where the DNA of Candelina submexicana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.7 °C 15.7–15.7

Seasonal swing summer↔winter9.60 °C

Max temp (day)22.0 °C

Min temp (night)9.00 °C

Precipitation34.7 mm/mo

Air humidity50.9 %

Moisture balance-93.3 mm/mo

Vapour deficit884 Pa

Wind speed4.10 m/s

Cloud cover25.5 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.