Candelariella medians

(Nyl.) A.L.Sm. · species

image placeholder — illustration coming later

Fungi/Ascomycota/Candelariomycetes/Candelariales/Candelariaceae/Candelariella

At a glance

Occurrence records9 883

Data sources8

Biological traits0

DNA specimens2

eDNA detections2

Sources8 archives

Databases and archives Candelariella medians's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility9 883 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionNPASS17 compounds

Occurrence & distributionGBIF9 883 records

Environmental DNA1 datasets · 2 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

01Narrative

Gelobde geelkorst is een korstmossoort uit de familie Candelariaceae.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition17 compounds

Compounds documented for Candelariella medians across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Terpenoid alkaloids12

Documented compounds17 total

Tissue Source Quantified only

Compound	Amount	Source
(1R,2S,3R,5R,6S,10S,16R,19R)-2,6-dimethyl-8-azahexacyclo[11.5.1.11,5.02,10.03,8.016,19]icos-13-ene-15,20-dione	present	NPASS
(1R,7R,10R,11S,15S,18R,23S)-11-methyl-5-oxa-13-azahexacyclo[11.9.1.01,7.07,15.010,23.018,22]tricos-21-en-4-one	present	NPASS
(1S,2S,3R,5R,6S,10S,16S)-16-hydroxy-2,6-dimethyl-8-azahexacyclo[11.5.1.11,5.02,10.03,8.016,19]icos-13(19)-ene-14,20-dione	present	NPASS
3-[(1R,2R,7S,10R,13R,14S)-1-methyl-14-propan-2-yl-12-azatetracyclo[8.6.0.02,13.03,7]hexadec-3-en-2-yl]propanoic acid	present	NPASS
BJEDIGDSPYXOHZ-JEWVLIIWSA-N	present	NPASS
Daphnicyclidin A	present	NPASS
Daphnipaxinin	present	NPASS
Daphniyunnine D	present	NPASS
LSKAYCSMVNNFJC-BOSSYYJLSA-N	present	NPASS
LSKAYCSMVNNFJC-QXLLIFFRSA-N	present	NPASS

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Candelariella medians has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes1

GenBank sequences2

eDNA detections2

Countries2

The DNA barcodea real sequence read deposited for this species

ITSEF535184.1 ↗478 bpSweden

ACGT

AAGAGTTAGGGTCTTCTGGCCCGACCTCCAACCCTATGTATATCTACCTCTGTTGCTTTGGCGGGCCCGCTGGGGAGACCCACCGCCGGC …

Candelariella medians strain SWE339 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS2

fungal barcode

08Occurrence & distribution

Record type9 883 records

Wild obs. + sensor9 677

Museum / vouchered201

Other5

Origin

Native147

Range

Area of Occupancy AOO24 052 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy62% within 1 km

≤100 m 5 413≤1 km 488≤10 km 3 650>10 km 4

9 555 georeferenced · 122 without coordinates

Open the mapobservation + sensor9 677

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy28% within 1 km

≤100 m 7≤1 km 31≤10 km 100

138 georeferenced · 63 without coordinates

Open the institutions mapphysical evidence201

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 33 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Uniwersytet Wrocławskilocation not on record	46
Entomological Society of Latvialocation not on record	34
TSBlocation not on record	27
LDlocation not on record	20
Senckenberg Gesellschaft für Naturforschung: Senckenberg Forschungsinstitut und Naturmuseumlocation not on record	5
Durham, US	4
Uppsala, SE	4
Madison, US	4
St. Paul, US	3
University of Gdansklocation not on record	3
BDBClocation not on record	3
ASUlocation not on record	3
Museo Achille Folettolocation not on record	3
CLUlocation not on record	3
Frauenfeld, CH	2
DOI/NPS, Colonial National Historical Parklocation not on record	2
US	2
Tilburg, NL	2
CJBGlocation not on record	2
Berlin, DE	1
Olocation not on record	1
València, ES	1
Bronx, US	1
Staatsarchiv Urilocation not on record	1
GZUlocation not on record	1
DClocation not on record	1
MAlocation not on record	1
Barcelona, ES	1
BClocation not on record	1
Kew, GB	1
McWane Science Centerlocation not on record	1
Adam Mickiewicz University in Poznańlocation not on record	1
Pretoria, ZA	1

33 institutions · 186 of 201 vouchered records shown · 13 without an institution code

09Environmental DNA2 detections

Where the DNA of Candelariella medians was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median6.80 °C 4.10–9.40

Seasonal swing summer↔winter16.9 °C

Max temp (day)9.30 °C 7.30–11.3

Min temp (night)3.90 °C 0.7–7.10

Precipitation77.6 mm/mo 64.9–90.4

Air humidity63.5 % 63.4–63.5

Moisture balance20.1 mm/mo 18.2–21.9

Vapour deficit410 Pa 363–458

Wind speed3.60 m/s 2.70–4.50

Cloud cover50.7 % 50.1–51.2

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Candelariella medians

At a glance

Sources8 archives

Compound class profile1 class

Documented compounds17 total

At a glance

Record type9 883 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions13 of 33 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type9 883 records