Canadanthus modestus

(Lindl.) G.L.Nesom · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Canadanthus

At a glance

Occurrence records1 149

Data sources12

Biological traits87

DNA specimens19

eDNA detections12

Sources12 archives

Databases and archives Canadanthus modestus's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 149 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI12 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics19 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources87 traits

Occurrence & distributionGBIF1 149 records

Environmental DNA1 datasets · 1 countries12 detections

DNA & barcodingBOLD · NCBI19 specimens

Genome at a glanceCCDB2n = 18

01Narrative

Canadanthus is a North American genus of flowering plants in the family Asteraceae.Nesom, Guy L. 1994. Phytologia 77(3): 250–251 The only known species is Canadanthus modestus, native to northern North America (Alaska, Yukon, British Columbia, Alberta, Manitoba, Saskatchewan, New Brunswick, Quebec, Ontario, Washington, Oregon, Idaho, Montana, North and South Dakota, Minnesota, Wisconsin, Michigan).Biota of North America Program 2014 state-level distribution map

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTUSDATRY

Size & morphology2

Plant height0.91 m

Seed mass0.849 mg

⚠ sources differ — TRY: 0.849 mg · GIFT: 1.42 mg

Life cycle & reproduction23

After harvest regrowth rateModerate

Bloom periodSummer

Coppice potentialNo

Flower colourpurple

Flower conspicuousYes

Fruit seed period beginSummer

Fruit seed period endFall

Growth rate USDAModerate

Life spanperennial

Lifespan categoryShort

Propagated by bare rootNo

Propagated by bulbNo

Propagated by containerNo

Propagated by cormNo

Propagated by cuttingsNo

Propagated by seedYes

Propagated by sodNo

Propagated by sprigsNo

Propagated by tubersNo

Resprout abilityNo

Seed spread rateSlow

Seedling vigorLow

Vegetative spread rateModerate

Diet & foraging1

Parasiteindependent

Habitat & environment24

Active growth periodSpring and Summer

Adapted to coarse textured soilsNo

Adapted to fine textured soilsNo

Adapted to medium textured soilsYes

Aquaticterrestrial

BloatNone

Climatesubalpine or subarctic

Climberself-supporting

Epiphyteterrestrial

Foliage colorGreen

Foliage porosity summerPorous

Foliage porosity winterPorous

Foliage textureMedium

Fruit colourbrown

Growth formherb

Growth form USDARhizomatous

Hedge toleranceNone

Known allelopathNo

Leaf retentionNo

Low growing grassNo

Root depth min10 in

Shape and orientationErect

Small grainNo

Woodinessnon-woody

Physiology & chemistry18

Anaerobic toleranceNone

C:N ratioMedium

Caco3 toleranceLow

Cold stratification requiredNo

Drought toleranceMedium

Fertility requirementLow

Fire resistantNo

Fire toleranceHigh

Frost free days min90 days

Moisture useMedium

Nitrogen fixation levelNone

Precipitation max40 in

Precipitation min16 in

Salinity toleranceNone

Shade toleranceHigh

Soil pH max7.5 pH

Soil pH min5.7 pH

Temperature min-38 °F

Uses & economy15

Berry nut seed productNo

Christmas tree productNo

Commercial availabilityNo Known Source

Fodder productNo

Lumber productNo

Naval store productNo

Nursery stock productNo

Palatable browse animalLow

Palatable graze animalLow

Palatable humanNo

Post productNo

Pulpwood productNo

Seeds per pound320 000 per lb

ToxicityNone

Veneer productNo

Other traits4

Fall conspicuousYes

Fruit seed abundanceMedium

Fruit seed conspicuousNo

Fruit seed persistenceYes

05DNA & barcoding19 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Canadanthus modestus has left across the world's sequence archives.

At a glance

DNA specimens19

Marker genes6

GenBank sequences10

eDNA detections12

Countries2

The DNA barcodea real sequence read deposited for this species

ITSMG219640.1 ↗340 bpCanada · 2000

ACGT

TGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATTCGGCTGAGGGCACGTCTGCCTGGGCGTCACGCATC …

Canadanthus modestus voucher BAB-2112 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★matK5★rbcL1★rbcLa★ITS4★ITS2

animal barcodeplant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Canadanthus modestus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Ploidydiploid inferred

Chromosome records18–182n range18median18mode10records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 1810×CCDB · ipcn-api-dl · CCDB · eflora · CCDB · Cave1958

CCDB · ipcn-api-dl — Semple, J. C. 1985. Chromosome number determinations in fam. Compositae tribe Astereae. Rhodora 87: 517–527.

CCDB · ipcn-api-dl — Chinnappa, C. C. & J. G. Chmielewski. 1987. Documented plant chromosome numbers 1987: 1. Miscellaneous counts from western North America. Sida 12: 409–417.

CCDB · ipcn-api-dl — Semple, J. C. 1983. Range expansion of Heterotheca camporum (Compositae: Asteraceae) in the southeastern United States. Brittonia 35(2): 140–146.

CCDB · ipcn-api-dl — Semple, J. C., J. G. Chmielewski & C. Xiang. 1992. Chromosome number determinations in fam. Compositae, tribe Astereae. IV. Additional reports and comments on the cytogeography and status of some species of Aster and Solidago. Rhodora 94: 48–62.

CCDB · ipcn-api-dl — Semple, J. C. 1981. In Chromosome number reports LXXll. Taxon 30: 703–704.

CCDB · ipcn-api-dl — Jones, A. G. 1980. Data on chromosome numbers in Aster (Asteraceae) with comments on the status and relationships of certain North American species. Brittonia 32(2): 240–261.

CCDB · ipcn-api-dl — Love, A. & D. Love. 1982. In: A Löve (ed.), IOPB chromosome number reports LXXV. Taxon 31(2): 344–360.

CCDB · ipcn-api-dl — Semple, J. C., C. Xiang, J. Zhang, M. Horsburgh & R. Cook. 2001. Chromosme number determinations in Fam. Compositae, tribe Astereae. VI. Western North American taxa and comments on generic treatments of North American asters. Rhodora 103: 202–218.

CCDB · eflora

CCDB · Cave1958 — Huziwara 1958b

n 91×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Jones, A. G. & R. A. Smogor. 1984. Chromosome Number Reports LXXXII. Taxon 33: 126–134.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 149 records

Wild obs. + sensor552

Museum / vouchered597

Range

Area of Occupancy AOO3 596 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy91% within 1 km

≤100 m 354≤1 km 38≤10 km 25>10 km 13

430 georeferenced · 122 without coordinates

Open the mapobservation + sensor552

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy57% within 1 km

≤100 m 37≤1 km 114≤10 km 94>10 km 18

263 georeferenced · 334 without coordinates

Open the institutions mapphysical evidence597

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions27 of 46 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pullman, US	97
Vancouver, CA	83
Corvallis, US	75
Moscow, US	54
Montréal, CA	45
WTUlocation not on record	35
Missoula, US	34
St. Paul, US	28
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	21
Bronx, US	18
Boise, US	10
DOI/NPS, Mount Rainier National Parklocation not on record	7
Whitehorse, CA	7
Québec, CA	6
Saint John, CA	6
Research Collection of B. A. Bennettlocation not on record	5
Wuzhou, CN	5
University of Alberta Museumslocation not on record	5
US	5
Moscow State Universitylocation not on record	4
WINlocation not on record	4
Cheney, US	3
Pocatello, US	3
Victoria, CA	2
Spearfish, US	2
DOI/NPS, Greenbelt Parklocation not on record	2
SEFlocation not on record	2
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	2
Meguro Parasitological Museumlocation not on record	1
Portland, US	1
Caldwell, US	1
University of Stellenboschlocation not on record	1
Stockholm, SE	1
Fargo, US	1
Pittsburg, US	1
IDElocation not on record	1
University of Guelph, OAC Herbariumlocation not on record	1
Provo, US	1
Université Lavallocation not on record	1
Canadian Department of Agriculturelocation not on record	1
Ashland, US	1
University of British Columbia, Herbariumlocation not on record	1
Acadia Universitylocation not on record	1
Tacoma, US	1
Macomb, US	1
Royal Alberta Museumlocation not on record	1

46 institutions · 588 of 597 vouchered records shown · 9 without an institution code

09Environmental DNA12 detections

Where the DNA of Canadanthus modestus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found12

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 12 detections have coordinates

Open the map1 country0

Riverbank.MacPherson Lake warm springsSwampy mineral seep dominated by Triglochin …

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median9.80 °C 6.90–13.7

Seasonal swing summer↔winter33.6 °C

Max temp (day)14.0 °C 10.8–19.4

Min temp (night)5.40 °C 2.20–9.10

Precipitation83.7 mm/mo 67.2–108

Air humidity59.6 % 55.2–62.9

Moisture balance-1.50 mm/mo -37.8–46.0

Vapour deficit481 Pa 396–672

Wind speed2.70 m/s 1.70–3.20

Cloud cover44.0 % 36.6–49.1

CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Canadanthus modestus

At a glance

Sources12 archives

Size & morphology2

Life cycle & reproduction23

Diet & foraging1

Habitat & environment24

Physiology & chemistry18

Uses & economy15

Other traits4

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 149 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions27 of 46 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 149 records