Campomanesia ilhoensis

Mattos · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Myrtales/Myrtaceae/Campomanesia

At a glance

Occurrence records152

Data sources8

Biological traits12

DNA specimens1

eDNA detections1

Sources8 archives

Databases and archives Campomanesia ilhoensis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility152 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources12 traits

Occurrence & distributionGBIF152 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Campomanesia ilhoensis (synonym Campomanesia viatoris) is a species of plant in the family Myrtaceae. The plant is endemic to the Atlantic Forest ecoregion in southeastern Brazil. It is occasionally distributed on the banks of the Rio Sâo Francisco in coastal Alagoas state.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFT

Size & morphology1

Plant height max4 m

Life cycle & reproduction3

Life formshrub or tree

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Growth formtree

Habitat GIFTCaatinga (stricto sensu), Floresta Ombrófila (= Floresta Pluvial), Restinga

Woodinesswoody

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Campomanesia ilhoensis has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes2

GenBank sequences3

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMH445990.1 ↗713 bpBrazil

ACGT

CCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAATCCTGCCTAGCAGAATG …

Campomanesia ilhoensis voucher Ibrahim 122 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type152 records

Wild obs. + sensor4

Museum / vouchered148

Origin

Native74

Range

Area of Occupancy AOO312 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 4

4 georeferenced

Open the mapobservation + sensor4

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 12

12 georeferenced · 136 without coordinates

Open the institutions mapphysical evidence148

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 31 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Masindi, UG	33
Universidade Federal de Sergipe (UFS)location not on record	23
Laboratorio de Ictiologialocation not on record	19
ASUlocation not on record	13
Feira de Santana, BR	10
Salvador, BR	6
UnBlocation not on record	5
Chaguaramas, TT	4
UFBAlocation not on record	4
Bronx, US	3
Instituto do Meio Ambientelocation not on record	3
Universidade Federal do Rio Grande do Nortelocation not on record	3
South Kensington, GB	2
Departamento de Sistematica e Ecologialocation not on record	2
Universidade Federal do Ceara, Departamento de Biologialocation not on record	2
Campo Mourão, BR	1
UNESP-IBILCElocation not on record	1
Kew, GB	1
HACAMlocation not on record	1
JBRJlocation not on record	1
Federal University of Espírito Santolocation not on record	1
UFSCarlocation not on record	1
Université de Bordeauxlocation not on record	1
San Jose State University, Museum of Birds and Mammalslocation not on record	1
UFESlocation not on record	1
UFPElocation not on record	1
UEMAlocation not on record	1
Fortaleza, BR	1
UESBlocation not on record	1
UTFPR-CPlocation not on record	1
UFVJMlocation not on record	1

31 institutions · 148 of 148 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Campomanesia ilhoensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)