Campanula scheuchzeri
Vill. · speciesAt a glance
Occurrence records57 638
Data sources9
Biological traits31
DNA specimens6
eDNA detections6
Sources9 archives
Databases and archives Campanula scheuchzeri's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility57 638 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics6 specimens↗
NCBIUS National Library of Medicinesequences↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
PloiDBPloidy Databasegenome & karyotypeOn this page6 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources31 traits
Occurrence & distributionGBIF57 638 records
Environmental DNA2 datasets · 2 countries6 detections
DNA & barcodingBOLD · NCBI6 specimens
Genome at a glanceCCDB2n = 68
01Narrative
Campanula scheuchzeri, la Campanule de Scheuchzer, est une espèce de plantes herbacées de montagnes appartenant à la famille des Campanulacées.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTLEDATRYWCVP
Size & morphology7
Leaf size57.85 mm²
Plant height0.165 m
⚠ sources differ — GIFT: 0.165 m · LEDA: 0.165 m · TRY: 0.2 m
Plant height generative0.117 m
Plant height max0.25 m
Plant height min0.1 m
Seed length0.65 mm
Seed mass0.104 mg
⚠ sources differ — TRY: 0.104 mg · LEDA: 0.14 mg · GIFT: 0.115 mg
Life cycle & reproduction8
Deciduousnessevergreen
Dispersal typeself
Flowering endAug
Flowering startJun
Life formperennial
Life spanperennial
Lifespan years7 years
Raunkiær life formhemicryptophyte
Diet & foraging1
Parasiteindependent
Habitat & environment6
Climatetemperate
Climberself-supporting
Epiphyteterrestrial
Growth formherb
Mycorrhiza type0.000000163
Woodinessnon-woody
Physiology & chemistry8
Leaf C:N ratio16.95 g/g
Leaf c463 mg/g
Leaf dry-matter content (LDMC)247 mg/g
Leaf n31.97 mg/g
Leaf p3.21 mg/g
Photosynthetic pathwayC3
Seed longevity index0
Specific leaf area (SLA)3.12 mm²/mg
Other traits1
Diaspore typeseed
05DNA & barcoding6 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Campanula scheuchzeri has left across the world's sequence archives.
At a glance
DNA specimens6
Marker genes4
GenBank sequences9
eDNA detections6
Countries2
The DNA barcodea real sequence read deposited for this species
ATCGCGTCGCCCCCCCAAGAAGCTTGGTGGGGAGCGTACATTGGCCTCCCGTGCCTCACCGTGCGGCTGGCTCAAAATGGAGTCCCCTAC …
Campanula scheuchzeri isolate MNI internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK3★rbcL3★ITS3★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB
The complete instruction manual Campanula scheuchzeri carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 68 n = 34
Ploidypolyploid inferred
Chromosome records16–1022n range68median68mode33records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 6819×CCDB · iber-fl · CCDB · fl-europaea · CCDB · ipcn-api-dl +4
CCDB · iber-fl — Biomtrie des graines et nombres chromosomiques dans la sous-section Heterophylla du genre Campanula (Campanulaceae). Geslot, A.Pl. Syst. Evol.134: 193-206(1980).
CCDB · iber-fl — Caryologie des Campanula subsect. Heterophylla (Wit.) Fed. Geslot, A.Phyton24(2): 173-191(1984).
CCDB · iber-fl — Les Campanules de la souc-section Heterophylla dans Pirenees. These, Univ. Droit D'Econom. Sci. Aix-Marseil. Geslot, A.*(1982).
CCDB · fl-europaea — Kovanda, 1970a
CCDB · ipcn-api-dl — Kovanda, M. & M. Ančev. 1989. The Campanula rotundifolia complex in Bulgaria. Preslia 61: 193–207.
CCDB · book-ipcn73-74 — GESLOT, A. 1973. Contribution a l'etude cytotaxinomique de Campanula rotundifolia dans les Pyrenees francaises et espagnoles. Phyton (Horn 1 1 15: 127 143. I
CCDB · book-atlas-flowering-plants — B0cher 1936
CCDB · Cave1962 — Gadella 1962b
CCDB · CromoCat 2015 — Geslot, A. (1982). Les Campanules de la souc-section Heterophylla dans Pyrénées: une étude de biosystematique. Tesis, Univ. Droit D'Econom. Sci. Marsella
CCDB · CromoCat 2015 — Ancev, M. E. (1983b). Citotaxonomicno izsledvane na vidovete ot grupata na Campanula rotundifolia v. Balgarija. V. Treta nacionalna konferencija po botanika : 240-247.
CCDB · CromoCat 2015 — Gadella, Th. W. J. (1962). Some cytological observations in the genus Campanula. Proc. Kon. Ned. Akad. Wetensch. Ser. C. C 65: 269-278
CCDB · CromoCat 2015 — Gadella, Th. W. J. (1964). Cytotaxonomic studies in the genus Campanula L.. Wentia 11: 1-104.
CCDB · CromoCat 2015 — Geslot, A. (1971). Des Campanula gr. rotundifolia dans les Pyrénées (Caryologie, Palynologie, Morphologie). Tesis Marsella
CCDB · CromoCat 2015 — Geslot, A. (1973). Contribution à l'étude cytotaxonomique de Campanula rotundifolia dans les Pyrénées françaises et espagnoles. Phyton (Horn) 15(1-2): 127-156.
CCDB · CromoCat 2015 — Geslot, A. (1980). Biométrie des graines et nombres chromosomiques dans la sous-section Heterophylla du genre Campanula (Campanulaceae). Pl. Syst. Evol. 134: 193-206.
CCDB · CromoCat 2015 — Geslot, A. (1984a). Caryologie des Campanula subsect. Heterophylla (Wit.) Fed.: Nouvelles numérations chromosomiques dans les Pyrénées. Phyton (Horn) 24(2): 173-191.
CCDB · CromoCat 2015 — Kovanda, M. & An?ev, M. (1989). The Campanula rotundifolia complex in Bulgaria. Preslia 61: 193-207.
CCDB · CromoCat 2015 — Lippert, W. & Heubl, G.R. (1988). Chromosomenzahlen von Pflanzen aus Bayern und angrenzeden Gebieten (Teil 1) Ber. Bayer. Bot. Ges. 59: 13-22.
2n 348×CCDB · iber-fl · CCDB · fl-europaea · CCDB · ipcn-api-dl +3
CCDB · iber-fl — Biomtrie des graines et nombres chromosomiques dans la sous-section Heterophylla du genre Campanula (Campanulaceae). Geslot, A.Pl. Syst. Evol.134: 193-206(1980).
CCDB · iber-fl — Les Campanules de la souc-section Heterophylla dans Pirenees. These, Univ. Droit D'Econom. Sci. Aix-Marseil. Geslot, A.*(1982).
CCDB · iber-fl — Caryologie des Campanula subsect. Heterophylla (Wit.) Fed. Geslot, A.Phyton24(2): 173-191(1984).
CCDB · fl-europaea — Podlech & Damboldt,
CCDB · ipcn-api-dl — NEGRE, R. & A. GESLOT. 1975. Les campanules du groupe rotundifolia dans les groupement a Festuca eskia et a Festuca paniculata en Pyrenees contrales. Bol. Soc. Brot., sér. 2 49: 29–58.
CCDB · book-ipcn73-74 — GESLOT, A. 1973. Contribution a l'etude cytotaxinomique de Campanula rotundifolia dans les Pyrenees francaises et espagnoles. Phyton (Horn 1 1 15: 127 143. I
CCDB · Cave1963 — Podlech & D. 1963
CCDB · CromoCat 2015 — Geslot, A. (1984a). Caryologie des Campanula subsect. Heterophylla (Wit.) Fed.: Nouvelles numérations chromosomiques dans les Pyrénées. Phyton (Horn) 24(2): 173-191.
2n 1024×CCDB · fl-europaea · CCDB · CromoCat 2015
CCDB · fl-europaea — Podlech Damboldt,
CCDB · CromoCat 2015 — Castroviejo & al. (2003). Flora Iberica (vol. I-VIII, X, XIV) Publicaciones del CSIC Madrid
CCDB · CromoCat 2015 — Geslot, A. (1971). Des Campanula gr. rotundifolia dans les Pyrénées (Caryologie, Palynologie, Morphologie). Tesis Marsella
CCDB · CromoCat 2015 — Geslot, A. (1973). Contribution à l'étude cytotaxonomique de Campanula rotundifolia dans les Pyrénées françaises et espagnoles. Phyton (Horn) 15(1-2): 127-156.
2n 162×CCDB · iber-fl · CCDB · book-atlas-flowering-plants
CCDB · iber-fl — Chromosome atlas of flowering plants. Darlintong, C. D. & A. P. Wylie.*(1955).
CCDB · book-atlas-flowering-plants — Sugiura 1942
n 344×CCDB · iber-fl · CCDB · CromoCat 2015
CCDB · iber-fl — Caryologie des Campanula subsect. Heterophylla (Wit.) Fed. Geslot, A.Phyton24(2): 173-191(1984).
CCDB · iber-fl — Les Campanules de la souc-section Heterophylla dans Pirenees. These, Univ. Droit D'Econom. Sci. Aix-Marseil. Geslot, A.*(1982).
CCDB · CromoCat 2015 — Geslot, A. (1982). Les Campanules de la souc-section Heterophylla dans Pyrénées: une étude de biosystematique. Tesis, Univ. Droit D'Econom. Sci. Marsella
CCDB · CromoCat 2015 — Geslot, A. (1984a). Caryologie des Campanula subsect. Heterophylla (Wit.) Fed.: Nouvelles numérations chromosomiques dans les Pyrénées. Phyton (Horn) 24(2): 173-191.
n 172×CCDB · iber-fl
CCDB · iber-fl — Les Campanules de la souc-section Heterophylla dans Pirenees. These, Univ. Droit D'Econom. Sci. Aix-Marseil. Geslot, A.*(1982).
CCDB · iber-fl — Caryologie des Campanula subsect. Heterophylla (Wit.) Fed. Geslot, A.Phyton24(2): 173-191(1984).
n 511×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Castroviejo & al. (2003). Flora Iberica (vol. I-VIII, X, XIV) Publicaciones del CSIC Madrid
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type57 638 records
Wild obs. + sensor55 639
Museum / vouchered1 660
Cultivated / captive3
Other336
Origin
Native1
Range
Area of Occupancy AOO25 976 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy28% within 1 km
≤100 m 5 502≤1 km 7 892≤10 km 35 027>10 km 159
48 580 georeferenced · 7 059 without coordinates
Open the mapobservation + sensor55 639
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy32% within 1 km
≤100 m 164≤1 km 188≤10 km 731>10 km 6
1 089 georeferenced · 571 without coordinates
Open the institutions mapphysical evidence1 660
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy
no georeferenced coordinates · 3 records without
Open the mapnot free-living3
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions29 of 69 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Salzburg, AT | 651 |
| Barcelona, ES | 70 |
| Zürich, CH | 68 |
| BDBClocation not on record | 62 |
| Vitoria, ES | 52 |
| Bern, CH | 52 |
| Olocation not on record | 44 |
| BFLlocation not on record | 41 |
| LDlocation not on record | 41 |
| Entomological Society of Latvialocation not on record | 35 |
| GJOlocation not on record | 35 |
| San Sebastián, ES | 32 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 30 |
| Provincia di Livornolocation not on record | 30 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 24 |
| MAlocation not on record | 23 |
| SZUlocation not on record | 23 |
| Adam Mickiewicz University in Poznańlocation not on record | 22 |
| Glarus, CH | 21 |
| Wlocation not on record | 19 |
| València, ES | 15 |
| LfUlocation not on record | 14 |
| Karlsruhe, DE | 14 |
| Oskarshamn, SE | 14 |
| BIO-UNIPIlocation not on record | 13 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 13 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 11 |
| GZUlocation not on record | 10 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 10 |
| Uniwersytet Wrocławskilocation not on record | 10 |
| Görlitz, DE | 10 |
| MeiseBGlocation not on record | 10 |
| BRNUlocation not on record | 9 |
| Berlin, DE | 9 |
| Porrentruy, CH | 8 |
| BClocation not on record | 8 |
| College of the Atlantic, Museumlocation not on record | 7 |
| Sion, CH | 7 |
| CICYTEXlocation not on record | 6 |
| Herb. BBGlocation not on record | 5 |
| Frankfurt am Main | 5 |
| OLAlocation not on record | 4 |
| Mlocation not on record | 4 |
| European Distributed Institute of Taxonomy (EDIT)location not on record | 4 |
| Pamplona, ES | 3 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 3 |
| CJBGlocation not on record | 3 |
| Salamanca, ES | 3 |
| Moscow State Universitylocation not on record | 3 |
| Zürich, CH | 3 |
| Paris, FR | 2 |
| Universität Göttingenlocation not on record | 2 |
| Dresden, DE | 2 |
| Pamplona, ES | 2 |
| PRClocation not on record | 2 |
| Saint Louis, US | 2 |
| Rotorua, NZ | 1 |
| Badajoz, ES | 1 |
| Granada, ES | 1 |
| Phyletisches Museum Jenalocation not on record | 1 |
| H-Schuhwlocation not on record | 1 |
| Museo Achille Folettolocation not on record | 1 |
| Lausanne, CH | 1 |
| John May Museum of Natural Historylocation not on record | 1 |
| Bangkok, TH | 1 |
| Madrid, ES | 1 |
| IPE-CSIClocation not on record | 1 |
| Uniwersytet Śląski w Katowicachlocation not on record | 1 |
| Québec, CA | 1 |
69 institutions · 1 638 of 1 660 vouchered records shown · 21 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA6 detections
Where the DNA of Campanula scheuchzeri was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found6
Studies independent surveys2
Countries2
Signal confidence: moderateweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 6 detections have coordinates
Open the map2 countries0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median9.30 °C 7.30–11.3
Seasonal swing summer↔winter19.7 °C
Max temp (day)13.3 °C 11.0–15.6
Min temp (night)3.80 °C 1.60–5.90
Precipitation180 mm/mo 105–254
Air humidity63.0 % 62.6–63.4
Moisture balance89.1 mm/mo 29.3–149
Vapour deficit477 Pa 387–567
Wind speed2.90 m/s 2.00–3.80
Cloud cover42.0 % 40.2–43.7
CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.