Campanula glomerata
speciesAt a glance
Occurrence records137 284
Data sources14
Biological traits48
DNA specimens56
eDNA detections31
Sources14 archives
Databases and archives Campanula glomerata's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility137 284 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI31 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics56 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources48 traits
Chemical compositionLOTUS · NPASS19 compounds
Occurrence & distributionGBIF137 284 records
Environmental DNA1 datasets · 6 countries31 detections
DNA & barcodingBOLD · NCBI56 specimens
Genome at a glanceCCDB · GoaT1.8 Gbp
01Narrative
La Campanule agglomérée, ou Campanule à fleurs agglomérées ou encore Ganteline (Campanula glomerata) est une plante herbacée vivace de la famille des Campanulacées.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTLEDATRYWCVP
Size & morphology10
Leaf mass42.1 mg
Leaf size714 mm²
⚠ sources differ — TRY: 714 mm² · LEDA: 936 mm² · GIFT: 916 mm²
Plant height0.173 m
⚠ sources differ — GIFT: 0.173 m · LEDA: 0.115 m · TRY: 0.388 m
Plant height generative0.475 m
Plant height max0.9 m
Plant height min0.05 m
Seed length1.23 mm
Seed mass0.13 mg
⚠ sources differ — TRY: 0.13 mg · LEDA: 0.127 mg · GIFT: 0.175 mg
Seed mass max0.26 mg
Seed mass min0.11 mg
Life cycle & reproduction15
Deciduousnessdeciduous
Dehiscencedehiscent
Dispersal typehuman
⚠ sources differ — LEDA: ethelochor · GIFT: autochorous
Flowering endAug
Flowering startJun
Life formperennial
Life spanperennial
Lifespan years2 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formhemicryptophyte
Reproduction asexualabsent
Seed number2 297
Self fertilizationabsent
Sex typehermaphrodite
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment10
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Epiphyteterrestrial
Fruit typecapsule
Growth formherb
Habitat GIFTcut-over forest, mountains
Leaf formcordate
Mycorrhiza typearbuscular
Woodinessnon-woody
Physiology & chemistry7
Leaf C:N ratio19.23 g/g
Leaf c465 mg/g
Leaf dry-matter content (LDMC)196 mg/g
⚠ sources differ — TRY: 196 mg/g · LEDA: 216 mg/g
Leaf n25.3 mg/g
Photosynthetic pathwayC3
Seed longevity index0.25
Specific leaf area (SLA)26.82 mm²/mg
⚠ sources differ — TRY: 26.82 mm²/mg · LEDA: 24.2 mm²/mg · GIFT: 24.38 mm²/mg
Other traits4
Diaspore typegenerative dispersule
Leaf margintoothed
Leaf spinesno
Leaf thornsno
03Chemical composition19 compounds
Compounds documented for Campanula glomerata across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Flavonols9
Cyclitols3
Cinnamic acids and derivatives2
Fatty alcohols1
Isocoumarins1
Documented compounds19 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (1S,3R,4R,5R)-1,3,4-trihydroxy-5-(1-oxoisochromen-4-yl)oxycyclohexane-1-carboxylic acid | present | LOTUS | |
| (2R,3R,4R,5S,6R)-2-(1,7-dihydroxytetradeca-4,12-dien-8,10-diyn-6-yloxy)-6-(hydroxymethyl)oxane-3,4,5-triol | present | LOTUS | |
| (2R,3R,4S,5S,6R)-2-[[(2R,3S,4S,5R,6R)-6-[(4E,6R,7R,12E)-1,7-dihydroxytetradeca-4,12-dien-8,10-diyn-6-yl]oxy-3,4,5-trihydroxyoxan-2-yl]methoxy]-6-(hydroxymethyl)oxane-3,4,5-triol | present | LOTUS | |
| (2S,3S,4R,5S,6S)-6-[2-(3,4-dihydroxyphenyl)-5,7-dihydroxy-4-oxochromen-3-yl]oxy-3,4,5-trihydroxyoxane-2-carboxylic acid | present | LOTUS | |
| 2-(3,4-dihydroxyphenyl)-5,7-dihydroxy-3-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-[[(2R,3S,4S,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxymethyl]oxan-2-yl]oxychromen-4-one | present | LOTUS | |
| 2-(3,4-dihydroxyphenyl)-5,7-dihydroxy-3-[(2S,3S,4R,5R,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxychromen-4-one | present | LOTUS | |
| 5,7-dihydroxy-2-(4-hydroxy-3-methoxyphenyl)-3-[(2S,3R,4R,5R,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxychromen-4-one | present | LOTUS | |
| 5,7-dihydroxy-2-(4-hydroxy-3-methoxyphenyl)-3-[(2S,3R,4R,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxychromen-4-one | present | LOTUS | |
| 5,7-dihydroxy-2-(4-hydroxyphenyl)-3-[(2S,3R,4R,5R,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxychromen-4-one | present | LOTUS | |
| citrate | present | NPASS |
05DNA & barcoding56 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Campanula glomerata has left across the world's sequence archives.
At a glance
DNA specimens56
Marker genes7
GenBank sequences10
eDNA detections31
Countries6
The DNA barcodea real sequence read deposited for this species
AGTCTTTGAACGCAAGTTGCGCCCGAAGCCTTTAGGCCGAGGGCACGTCTGCATGGGCGTCACGCATCGCGTCGCCCCCCCCCAAACACT …
Campanula glomerata voucher EDNA21-0061459 internal transcribed spacer region, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK5★rbcL1★rbcLa★ITS4★ITS1★ITS2trnH-psbA
plant barcodefungal barcodemarker
06Genome at a glanceCCDB · GoaT
The complete instruction manual Campanula glomerata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size1 789 740 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Campanula glomerata1.79 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 30 n = 15
Ploidy2× diploid · measured
Chromosome records30–902n range30median30mode74records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 3054×GoaT · DTOL Flowering Plants Estimates Kew · GoaT · Kew Plant DNA C-values Database · CCDB · slov-fl +12
GoaT · DTOL Flowering Plants Estimates Kew
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · slov-fl — Kovanda M., 1983: Chromosome numbers in selected Angiosperms (1). - Preslia 55/3: 193-205.
CCDB · slov-fl — Májovský J. et al., 1970b: Index of chromosome numbers of Slovakian flora Part 2. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 18: 45-60.
CCDB · slov-fl — Májovský J. et al., 1974a: Index of chromosome numbers of Slovakian flora (Part 3). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 22: 1-20.
CCDB · slov-fl — Uhríková A. & Bernátová D., 2000: Karyologické štúdium slovenskej flóry XXXII. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 40: 31-36.
CCDB · slov-fl — Májovský J. et al., 1978: Index of chromosome numbers of Slovakian flora (Part 6). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 26: 1-42.
CCDB · slov-fl — Gadella T. W. J., 1964: Cytotaxonomic studies in the genus Campanula. - Wentia 11: 1-104.
CCDB · slov-fl — Uhríková A. & Dúbravcová Z., 1997: The chromosome numbers of some selected plant species of flora in Slovakia. - Oecologia Montana 6/1-2: 1-3.
CCDB · slov-fl — Májovský J., Uhríková A., Javorčíková D., Mičieta K., Králik E., Dúbravcová Z., Feráková V., Murín A., Černušáková D., Hindáková M., Schwarzová T. & Záborský J., 2000: Prvý doplnok karyotaxonomického prehľadu flóry Slovenska. - Acta Fac. Rerum Nat. Univ. Comen., Bot. Supplementum Nr. 1: 1-127.
CCDB · brit-fl — Gadella, T.W.J. Wentia 11: 1-104 (1964)
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=3746
CCDB · fl-europaea — Gadella, 1964
CCDB · fl-europaea — Majovsky et al., 19"
CCDB · poland — Gadella Th. W. J. 1964. Cytotaxonomic studies in the Campanula genus. Wentia 11, 1-104.
CCDB · poland — Wcis?o H. 1983. Cytological observations on Campanulaceae from Poland. Acta Biol. Cracov. Ser. Bot. 25, 1-13.
CCDB · mediterranean
CCDB · ipcn-api-dl — HINDAKOVA, M. 1978. In Index of chromosome numbers of Slovakian flora. Part 6. Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 26: 1–42.
CCDB · ipcn-api-dl — Wcislo, H. 1983. Cytological observations on Campanulaceae from Poland. Acta Biol. Cracov., Ser. Bot. 25: 1–13.
CCDB · ipcn-api-dl — Krasnikov, A. A. & D. N. Schaulo. 1990. Chromosome numbers in representatives of some families of vascular plants in the flora of the Novosibirsk region. II. Bot. Žhurn. (Moscow & Leningrad) 75: 118–120.
CCDB · ipcn-api-dl — Dmitrieva, S. A. 1986. Chisla khromosom nekotorych vidov rastenij Berezinskogo Biosfernogo Zapovednika. Zapov. Belorussii Issl. 10: 24–28.
CCDB · ipcn-api-dl — Lövkvist, B. & U. M. Hultgård. 1999. Chromosome numbers in south Swedish vascular plants. Opera Bot. 137: 1–42.
CCDB · ipcn-api-dl — Abou-El-Enain. 2006. Interspecific and phylogenetic relationships in the genus Campanula L. s. str. (Campanulaceae): karyological approach. Cytologia 71(2): 93–100.
CCDB · ipcn-api-dl — Contandriopoulos, J. 1980. In IOPB chromosome number reports LXVI. Taxon 29: 163–164.
CCDB · ipcn-api-dl — Krasnoborov, I. M., T. S. Rostovtseva & S. A. Ligus. 1980. Chromosome numbers of some plant species of South Siberia and the Far East. Bot. Zhurn. 65 (5): 659–668.
CCDB · ipcn-api-dl — Kovanda, M. 1983. Chromosome numbers in selected Angiosperms (1). Preslia 55: 193–205.
CCDB · ipcn-api-dl — Anchev, M. E. 1993. Mediterranean chromosome number reports 3 (217--227). Fl. Medit. 3: 358–363.
CCDB · book-ipcn67-71 — MAJOVSKY, J., ET. AL. 1970. Index of chromosome numbers of Slovakian flora. (Part 2). Acta Fae. Rerum Nat. Univ. Comenianae Bot. 18: 45-60.
CCDB · book-ipcn67-71 — CONTANDRIOPOULOS, J. 1966. Contribution a l'etude cytotaxinomique des Campanulacees de Grece. II. Bull. Soc. Bot. France 113: 453-474.
CCDB · book-ipcn67-71 — ZHUKOVA, P. G. 1967. Karyology of some plants, cultivated in the Arctic-Alpine Botanical Garden. (In Russian). In N. A. Avrorin (ed.): Plantarum in Zonam Polarem Transportatio. II. Leningrad 1967, pp. 139-149.
CCDB · book-ipcn75-78 — Hindakova 1978
CCDB · book-northern-plants — Griesinger 1937.
CCDB · Cave1962 — Gadella 1962b
CCDB · Cave1963 — Gadella 1963b
CCDB · CromoCat 2015 — Ancev, M. E. (1988). Karyological study of Bulgarian Campanulaceae. In: 100 ann. acad. N. Stojanov : 125-137.
CCDB · CromoCat 2015 — Gadella, Th. W. J. (1962). Some cytological observations in the genus Campanula. Proc. Kon. Ned. Akad. Wetensch. Ser. C. C 65: 269-278
CCDB · CromoCat 2015 — Gadella, Th. W. J. (1963). Some cytological observations in the genus Campanula. II. Proc. Kon. Ned. Akad. Wetensch. C 66: 270-283.
CCDB · CromoCat 2015 — Gadella, Th. W. J. (1964). Cytotaxonomic studies in the genus Campanula L.. Wentia 11: 1-104.
CCDB · CromoCat 2015 — Griesinger, R. (1937). Uber hypo und hyperdiploide formen von Petunia, Hyoscyamus, Lamium und einige andere chromosomenzählungen. Ber. Deutsch. Bot. Ges. 55: 556-571.
CCDB · CromoCat 2015 — Kovanda, M. (1983). Chromosome numbers in selected Angiosperms (1). Preslia 55: 193-205.
+1 more references
2n 349×CCDB · iapt · CCDB · ipcn-api-dl · CCDB · book-ipcn75-78 +2
CCDB · iapt — IAPT/IOPB Chromosome Data 6
CCDB · ipcn-api-dl — Krogulevich, R. E. 1978. Kariologicheskij analiz vidov flory Vostochnogo Sajana. V Flora Pribajkal'ja. 19–48. Nauka, Novosibirsk.
CCDB · ipcn-api-dl — Krogulevich, R. E. 1976. Chromosome numbers of plant species from the Tunkinsky Alpes (East Sayan). News Sib. Depart. Acad. Sci. USSR, Ser. Biol. 15(3): 46–52.
CCDB · book-ipcn75-78 — Krogulevich 1978
CCDB · book-ipcn75-78 — Krogulevich 1976
CCDB · book-northern-plants — Marchal 1920.
CCDB · CromoCat 2015 — Krogulevich, R. E. (1976b). Chromosome numbers of plant species from the Tunkinsky Alpes (East Sayan). News Sib. Depart. Ac. Sci. USSR, ser. Biol. 15(3): 46-52 (In Russian)
CCDB · CromoCat 2015 — Krogulevich, R. E. (1978a). Kariologicheskij analiz vidov flory Vostochnogo Sajana. V Flora Pribajkal'ja. 19-48. Nauka, Novosibirsk.
2n 908×CCDB · ipcn-api-dl · CCDB · book-ipcn66 · CCDB · Cave1963 +2
CCDB · ipcn-api-dl — Daniela, I. 1997. IOPB chromosome data 11. Newslett. Int. Organ. Pl. Biosyst. (Oslo) 26/27: 14.
CCDB · ipcn-api-dl — Gadnidze, R. I., T. N. Gviniashvili, I. M. Danelia & M. V. Churadze. 1998. Chromosome numbers of the species of the Georgian flora. Bot. Žhurn. (Moscow & Leningrad) 83(10): 143–147.
CCDB · book-ipcn66 — Gadella 1966b
CCDB · Cave1963 — Gadella 1963b
CCDB · CromoCat 2015 — Contandriopoulos, J. (1980a). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXVI]. Taxon 29(1): 163-164.
CCDB · CromoCat 2015 — Contandriopoulos, J. (1980b). Contribution à l'étude cytotaxonomique des Campanulacées de l'Iran. Revue Biologie-Ecologie Mediterranéenne 7(1): 27-36.
CCDB · iapt — IAPT/IOPB Chromosome Data 19
2n 682×CCDB · slov-fl · CCDB · book-northern-plants
CCDB · slov-fl — Májovský J., Murín A., Feráková V., Hindáková M., Schwarzová T., Uhríková A., Váchová M. & Záborský J., 1987: Karyotaxonomický prehľad flóry Slovenska. Veda, Bratislava.
CCDB · book-northern-plants — Sugiura 1939.
2n 601×CCDB · book-ipcn72
CCDB · book-ipcn72 — CONTANDRIOPOULUS, J. 1972. Contribution a lietude cytotaxononique des Campanulacees du Proche-Orient, III. Bull. Soc. Bot. France 119: 75-9,4.
n 152×CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · ipcn-api-dl — Contandriopoulos, J. 1980. In IOPB chromosome number reports LXVI. Taxon 29: 163–164.
CCDB · CromoCat 2015 — Contandriopoulos, J. (1980b). Contribution à l'étude cytotaxonomique des Campanulacées de l'Iran. Revue Biologie-Ecologie Mediterranéenne 7(1): 27-36.
n 01×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Krogulevich, R. E. (1976b). Chromosome numbers of plant species from the Tunkinsky Alpes (East Sayan). News Sib. Depart. Ac. Sci. USSR, ser. Biol. 15(3): 46-52 (In Russian)
n 451×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Contandriopoulos, J. (1980b). Contribution à l'étude cytotaxonomique des Campanulacées de l'Iran. Revue Biologie-Ecologie Mediterranéenne 7(1): 27-36.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type137 284 records
Wild obs. + sensor129 046
Museum / vouchered7 320
Cultivated / captive22
Other896
Origin
Native3 110
Introduced132
Range
Area of Occupancy AOO231 428 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy59% within 1 km
≤100 m 39 531≤1 km 16 831≤10 km 37 901>10 km 2 071
96 334 georeferenced · 32 712 without coordinates
Open the mapobservation + sensor129 046
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy44% within 1 km
≤100 m 670≤1 km 1 266≤10 km 2 206>10 km 257
4 399 georeferenced · 2 921 without coordinates
Open the institutions mapphysical evidence7 320
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
≤10 km 6>10 km 4
10 georeferenced · 12 without coordinates
Open the mapnot free-living22
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions100 of 212 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 1 249 |
| Moscow State Universitylocation not on record | 686 |
| Kuopio, FI | 336 |
| South Kensington, GB | 324 |
| Instytut Ochrony Przyrody Polskiej Akademii Nauklocation not on record | 236 |
| BIO-UNIPIlocation not on record | 219 |
| BFLlocation not on record | 206 |
| Olocation not on record | 167 |
| Salzburg, AT | 154 |
| Oulu, FI | 145 |
| Institute of Applied Ecology, Academia Sinicalocation not on record | 134 |
| LDlocation not on record | 133 |
| Adam Mickiewicz University in Poznańlocation not on record | 126 |
| MeiseBGlocation not on record | 113 |
| Jyväskylä, FI | 111 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 111 |
| TROMlocation not on record | 96 |
| SLU Artdatabankenlocation not on record | 95 |
| Tartu, EE | 94 |
| Oskarshamn, SE | 86 |
| Tallinn, EE | 80 |
| València, ES | 80 |
| Uppsala, SE | 76 |
| Turku, FI | 71 |
| Görlitz, DE | 71 |
| BDBClocation not on record | 67 |
| Beijing, CN | 66 |
| Barcelona, ES | 63 |
| Berlin, DE | 61 |
| BRNUlocation not on record | 60 |
| MAlocation not on record | 60 |
| Trondheim, NO | 60 |
| KMNlocation not on record | 60 |
| Vitoria, ES | 50 |
| Provincia di Livornolocation not on record | 41 |
| San Sebastián, ES | 38 |
| Entomological Society of Latvialocation not on record | 33 |
| Helsinki, FI | 30 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 29 |
| Dresden, DE | 29 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 28 |
| Tula State Universitylocation not on record | 27 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 25 |
| Wlocation not on record | 23 |
| Frankfurt am Main | 23 |
| BClocation not on record | 21 |
| Porvoo, FI | 20 |
| NSMKlocation not on record | 20 |
| Mlocation not on record | 18 |
| WNNUlocation not on record | 18 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 17 |
| LfUlocation not on record | 15 |
| TUR-Alocation not on record | 15 |
| PRClocation not on record | 15 |
| Uniwersytet Warszawskilocation not on record | 14 |
| GJOlocation not on record | 14 |
| Frauenfeld, CH | 13 |
| Urumqi, CN | 13 |
| Bergen, NO | 12 |
| Pamplona, ES | 12 |
| IWEP FEB RASlocation not on record | 12 |
| Porrentruy, CH | 11 |
| Denver, US | 11 |
| Inner Mongolia Universitylocation not on record | 11 |
| Salamanca, ES | 10 |
| The State Museum-Preserve "The Kulikovo pole"location not on record | 9 |
| Pamplona, ES | 9 |
| Saint Louis, US | 9 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 9 |
| Philadelphia, US | 8 |
| Tromso University Museumlocation not on record | 8 |
| College of the Atlantic, Museumlocation not on record | 8 |
| Northeast Institute of Geography and Agroecology, Chinese Academy of Scienceslocation not on record | 7 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 7 |
| Alicante, ES | 7 |
| The Tula Region State Institution of Culture "Tula Museum Association"location not on record | 7 |
| GZUlocation not on record | 7 |
| Fulda, DE | 6 |
| PrivatHerblocation not on record | 6 |
| Urumqi, CN | 6 |
| Québec, CA | 6 |
| Paris, FR | 6 |
| UGentlocation not on record | 6 |
| Madrid, ES | 6 |
| Bourges, FR | 5 |
| Nanjing, CN | 5 |
| Vancouver, CA | 5 |
| Rovaniemi, FI | 5 |
| Guangzhou, CN | 5 |
| NMBU:MINAlocation not on record | 5 |
| Xining, CN | 5 |
| CICYTEXlocation not on record | 5 |
| Podgorica, ME | 5 |
| CJBGlocation not on record | 5 |
| ENTClocation not on record | 5 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 4 |
| Flagstaff, US | 4 |
| Yangling, CN | 4 |
| H-Schuhwlocation not on record | 4 |
| WTUlocation not on record | 4 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 4 |
| Forssa, FI | 4 |
| Badajoz, ES | 4 |
| Natural History Museum Rotterdamlocation not on record | 4 |
| Karlsruhe, DE | 4 |
| Prioksko-Terrasnyi Biosphere Reservelocation not on record | 4 |
| University of Alberta Museumslocation not on record | 4 |
| DBF-NHMDlocation not on record | 4 |
| OLAlocation not on record | 4 |
| CASlocation not on record | 4 |
| Herbarium of South China Botanical Gardenlocation not on record | 3 |
| JMSlocation not on record | 3 |
| Kunming, CN | 3 |
| Wellington, NZ | 3 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 3 |
| Komarov Botanical Institutelocation not on record | 3 |
| Burlington, US | 3 |
| Canadian Department of Agriculturelocation not on record | 3 |
| John May Museum of Natural Historylocation not on record | 2 |
| Musée des Confluenceslocation not on record | 2 |
| Bronx, US | 2 |
| Chengdu, CN | 2 |
| Muséum Henri Lecoqlocation not on record | 2 |
| No collectionlocation not on record | 2 |
| Salvador, BR | 2 |
| Uniwersytet Śląski w Katowicachlocation not on record | 2 |
| Durham, US | 2 |
| Christchurch, NZ | 2 |
| University of Guelph, OAC Herbariumlocation not on record | 2 |
| Université Lavallocation not on record | 2 |
| SZUlocation not on record | 2 |
| Missoula, US | 2 |
| Uniwersytet Opolskilocation not on record | 2 |
| Xian, CN | 2 |
| FLADlocation not on record | 2 |
| Tilburg, NL | 2 |
| Museo Achille Folettolocation not on record | 2 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 2 |
| National Museum Waleslocation not on record | 2 |
| Zürich, CH | 2 |
| Acadia Universitylocation not on record | 2 |
| Dhaka, BD | 2 |
| Boumlocation not on record | 2 |
| Auckland, NZ | 2 |
| GMBAlocation not on record | 2 |
| Chongqing Museumlocation not on record | 2 |
| Musee National d'histoire Naturelle Luxembourglocation not on record | 2 |
| Madrid, ES | 1 |
| Bern, CH | 1 |
| Davenport, US | 1 |
| PTHlocation not on record | 1 |
| Institute of Botany, Ilia State Universitylocation not on record | 1 |
| nbflocation not on record | 1 |
| H-Dunkellocation not on record | 1 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 1 |
| Kandalaksha State Nature Reservelocation not on record | 1 |
| Granada, ES | 1 |
| UoB-IBlocation not on record | 1 |
| University of Wisconsinlocation not on record | 1 |
| Pullman, US | 1 |
| Taipei, TW | 1 |
| Tulane Universitylocation not on record | 1 |
| Jiangxi College of Educationlocation not on record | 1 |
| BSBIlocation not on record | 1 |
| Mexico City, MX | 1 |
| Wuzhou, CN | 1 |
| Moscow, US | 1 |
| H-Wolflocation not on record | 1 |
| Forest Survey and Design Institute, Forestry Administrative Bureau of Daxinganlinglocation not on record | 1 |
| Provo, US | 1 |
| NoColllocation not on record | 1 |
| WINlocation not on record | 1 |
| Green Bay, US | 1 |
| Xinjiang Institute of Ecology and Geography, Chinese Academy of Scienceslocation not on record | 1 |
| Cheney, US | 1 |
| Uniwersytet Marii Curie-Skłodowskiejlocation not on record | 1 |
| KRA (gel)location not on record | 1 |
| IPE-CSIClocation not on record | 1 |
| University of Lethbridgelocation not on record | 1 |
| University of New Hampshirelocation not on record | 1 |
| ULBF-AGRlocation not on record | 1 |
| Royal Botanic Garden Edinburghlocation not on record | 1 |
| Xiamen, CN | 1 |
| UTFPR-CPlocation not on record | 1 |
| Edinburgh, GB | 1 |
| Anchorage, US | 1 |
| Monastir, TN | 1 |
| Namur, BE | 1 |
| Tampere, FI | 1 |
| Universität Göttingenlocation not on record | 1 |
| Jagiellonian Universitylocation not on record | 1 |
| Nijmegen, NL | 1 |
| McWane Science Centerlocation not on record | 1 |
| Mississippi State, US | 1 |
| Stockholm, SE | 1 |
| Glarus, CH | 1 |
| Philadelphia, US | 1 |
| Sion, CH | 1 |
| Ann Arbor, US | 1 |
| Emporia, US | 1 |
| Bloomington, US | 1 |
| Macomb, US | 1 |
| Sant Julià de Lòria, AD | 1 |
| Winterthur, CH | 1 |
| Dekalb, US | 1 |
| Samara National Research Universitylocation not on record | 1 |
| Zürich, CH | 1 |
| New Brunswick, US | 1 |
| Toronto, CA | 1 |
| St. Paul, US | 1 |
| Madison, US | 1 |
| Umeå Universitylocation not on record | 1 |
212 institutions · 6 763 of 7 320 vouchered records shown · 459 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA31 detections
Where the DNA of Campanula glomerata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found31
Studies independent surveys1
Countries6
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 31 detections have coordinates
Open the map6 countries0
Under the forestUnder spruce foreston rough ground in car park area
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median12.4 °C 10.0–19.0
Seasonal swing summer↔winter25.8 °C
Max temp (day)16.4 °C 11.7–24.2
Min temp (night)8.50 °C 3.10–16.1
Precipitation83.5 mm/mo 15.7–112
Air humidity59.9 % 45.7–64.7
Moisture balance-28.8 mm/mo -95.2–21.7
Vapour deficit682 Pa 438–929
Wind speed3.90 m/s 2.80–4.80
Cloud cover41.1 % 27.5–66.9
CHELSA 1981–2010, ~9 km grid, at location & month of 28 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.