Campanula excisa

Schleich. ex Murith · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Campanulaceae/Campanula

At a glance

Occurrence records1 225

Data sources9

Biological traits11

DNA specimens1

eDNA detections0

Sources9 archives

Databases and archives Campanula excisa's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 225 records↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources11 traits

Occurrence & distributionGBIF1 225 records

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 34

01Narrative

Die Ausgeschnittene Glockenblume (Campanula excisa) ist eine Pflanzenart aus der Gattung Glockenblumen (Campanula) innerhalb der Familie der Glockenblumengewächse (Campanulaceae).

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology2

Plant height0.085 m

Seed mass0.062 mg

Life cycle & reproduction3

Life formperennial

Life spanperennial

Raunkiær life formhemicryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment5

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Campanula excisa has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes2

GenBank sequences2

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLKJ512631.1 ↗1 075 bp

ACGT

CCTTGATCGTTACAAAGGGAGATGCTATCACATCGAGCCCGTTGCCGGAGAAGAAAATCAATTTATTGCTTATGTAGCTTACCCATTAGA …

Campanula excisa ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Campanula excisa carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 34 n = 17

Ploidypolyploid inferred

Chromosome records34–342n range34median34mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 342×CCDB · fl-europaea · CCDB · Cave1963

CCDB · fl-europaea — Podlech, 1962

CCDB · Cave1963 — Podlech 1962

n 171×CCDB · book-ipcn65

CCDB · book-ipcn65 — Favarger 1965a

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 225 records

Wild obs. + sensor1 008

Museum / vouchered216

Other1

Range

Area of Occupancy AOO724 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy8% within 1 km

≤100 m 49≤1 km 26≤10 km 902>10 km 17

994 georeferenced · 14 without coordinates

Open the mapobservation + sensor1 008

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy9% within 1 km

≤1 km 4≤10 km 40

44 georeferenced · 172 without coordinates

Open the institutions mapphysical evidence216

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Zürich, CH	71
Zürich, CH	67
Bern, CH	25
LDlocation not on record	15
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	10
Oskarshamn, SE	7
Institut und Museum fuer Geologie und Palaeontologielocation not on record	6
Sion, CH	3
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	3
Porrentruy, CH	2
Adam Mickiewicz University in Poznańlocation not on record	2
Bourges, FR	2
Universität Basel, Herbariumlocation not on record	1
Berlin, DE	1
San Jose State University, Museum of Birds and Mammalslocation not on record	1

15 institutions · 216 of 216 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Campanula excisa

At a glance

Sources9 archives

Size & morphology2

Life cycle & reproduction3

Diet & foraging1

Habitat & environment5

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 225 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions8 of 15 geolocated

Record type1 225 records